EMAIL THIS PAGE TO A FRIEND

ME1

malic enzyme 1, NADP(+)-dependent, cytosolic

64 Gene Product Result for
Synonyms: HUMNDME MES
Gene ID:
Human(4199) Summary: This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
Mouse(17436) malic enzyme 1, NADP(+)-dependent, cytosolic
Rat(24552) malic enzyme 1, NADP(+)-dependent, cytosolic
Zebrafish(768196) malic enzyme 1, NADP(+)-dependent, cytosolic
cow(540985) malic enzyme 1, NADP(+)-dependent, cytosolic
Horse(100070127) malic enzyme 1, NADP(+)-dependent, cytosolic
domestic cat(101082153) malic enzyme 1, NADP(+)-dependent, cytosolic
dog(403709) malic enzyme 1, NADP(+)-dependent, cytosolic
chicken(374189) malic enzyme 1, NADP(+)-dependent, cytosolic
Goat(100860863) malic enzyme 1, NADP(+)-dependent, cytosolic
sheep(100189620) malic enzyme 1, NADP(+)-dependent, cytosolic
domestic guinea pig(100728635) malic enzyme 1, NADP(+)-dependent, cytosolic
naked mole-rat(101717382) malic enzyme 1, NADP(+)-dependent, cytosolic
Domestic Rabbit(100355457) malic enzyme 1, NADP(+)-dependent, cytosolic
Gene Class: Dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002395 Rosetta Predictions human pricing
NM_012600 Rosetta Predictions rat pricing
NM_008615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026762 predicted 1908
2 SASI_Hs01_00026763 predicted 1838
3 SASI_Hs01_00026764 predicted 978
4 SASI_Hs01_00026766 predicted 1091
5 SASI_Hs02_00333756 predicted 1456
6 SASI_Hs02_00333757 predicted 1583
7 SASI_Hs01_00026768 predicted 560
8 SASI_Hs01_00026769 predicted 587
9 SASI_Hs01_00026770 predicted 1536
10 SASI_Hs02_00333758 predicted 966
11 SASI_Hs01_00026765 predicted 1813
12 SASI_Hs01_00026767 predicted 404
13 SASI_Hs01_00026771 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259753 predicted 1622
2 SASI_Rn02_00259754 predicted 387
3 SASI_Rn02_00259755 predicted 1704
4 SASI_Rn01_00070926 predicted 1125
5 SASI_Rn02_00259756 predicted 240
6 SASI_Rn02_00259757 predicted 1647
7 SASI_Rn02_00259758 predicted 322
8 SASI_Rn01_00070930 predicted 790
9 SASI_Rn01_00070932 predicted 769
10 SASI_Rn02_00259759 predicted 1485
11 SASI_Rn01_00070927 predicted 1474
12 SASI_Rn01_00070928 predicted 1360
13 SASI_Rn01_00070929 predicted 1163
14 SASI_Rn01_00070931 predicted 1053
15 SASI_Rn01_00070933 predicted 1353
16 SASI_Rn01_00070934 predicted 775
17 SASI_Rn01_00070935 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314288 predicted 1786
2 SASI_Mm01_00139218 predicted 373
3 SASI_Mm01_00139219 predicted 1282
4 SASI_Mm02_00314289 predicted 409
5 SASI_Mm01_00139221 predicted 403
6 SASI_Mm02_00314290 predicted 1809
7 SASI_Mm01_00139222 predicted 427
8 SASI_Mm02_00314291 predicted 1860
9 SASI_Mm01_00139224 predicted 1511
10 SASI_Mm01_00139225 predicted 936
11 SASI_Mm01_00139217 predicted 1124
12 SASI_Mm01_00139220 predicted 1011
13 SASI_Mm01_00139223 predicted 863
14 SASI_Mm01_00139226 predicted 892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008615
VALIDATED
ME1 MISSION shRNA Bacterial Glycerol Stock
malic enzyme 1, NADP(+)-dependent, cytosolic
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008615.2-2236s21c1
Sequence:CCGGACAGTTCTTTCTTGACTATTTCTCGAGAAATAGTCAAGAAAGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-870s21c1
Sequence:CCGGTATGGCATGAATTGCCTTATTCTCGAGAATAAGGCAATTCATGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2064s21c1
Sequence:CCGGTTCACTTACTGTGGATATTTACTCGAGTAAATATCCACAGTAAGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2159s21c1
Sequence:CCGGCTGATATGTAGGAAGCTAATGCTCGAGCATTAGCTTCCTACATATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-395s1c1
Sequence:CCGGCCAGCAGTACAGTTTGGCATTCTCGAGAATGCCAAACTGTACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-2866s1c1
Sequence:CCGGCCTGACTTTGAAGTTGCTTTACTCGAGTAAAGCAACTTCAAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008615.1-173s1c1
Sequence:CCGGGCAGTTGAACATTCATGGATTCTCGAGAATCCATGAATGTTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-1605s1c1
Sequence:CCGGGCAGTAAAGATTGTGCAAGATCTCGAGATCTTGCACAATCTTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-843s1c1
Sequence:CCGGCGAAACAAGTATTGCACATTTCTCGAGAAATGTGCAATACTTGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008615
VALIDATED
ME1 MISSION shRNA shRNA Plasmid DNA
malic enzyme 1, NADP(+)-dependent, cytosolic
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008615.2-2236s21c1
Sequence:CCGGACAGTTCTTTCTTGACTATTTCTCGAGAAATAGTCAAGAAAGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-870s21c1
Sequence:CCGGTATGGCATGAATTGCCTTATTCTCGAGAATAAGGCAATTCATGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2064s21c1
Sequence:CCGGTTCACTTACTGTGGATATTTACTCGAGTAAATATCCACAGTAAGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2159s21c1
Sequence:CCGGCTGATATGTAGGAAGCTAATGCTCGAGCATTAGCTTCCTACATATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-395s1c1
Sequence:CCGGCCAGCAGTACAGTTTGGCATTCTCGAGAATGCCAAACTGTACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-2866s1c1
Sequence:CCGGCCTGACTTTGAAGTTGCTTTACTCGAGTAAAGCAACTTCAAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008615.1-173s1c1
Sequence:CCGGGCAGTTGAACATTCATGGATTCTCGAGAATCCATGAATGTTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-1605s1c1
Sequence:CCGGGCAGTAAAGATTGTGCAAGATCTCGAGATCTTGCACAATCTTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-843s1c1
Sequence:CCGGCGAAACAAGTATTGCACATTTCTCGAGAAATGTGCAATACTTGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008615
VALIDATED
ME1 MISSION shRNA Lentiviral Transduction Particles
malic enzyme 1, NADP(+)-dependent, cytosolic
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375959    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008615.2-2236s21c1
Sequence:CCGGACAGTTCTTTCTTGACTATTTCTCGAGAAATAGTCAAGAAAGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-870s21c1
Sequence:CCGGTATGGCATGAATTGCCTTATTCTCGAGAATAAGGCAATTCATGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2064s21c1
Sequence:CCGGTTCACTTACTGTGGATATTTACTCGAGTAAATATCCACAGTAAGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008615.2-2159s21c1
Sequence:CCGGCTGATATGTAGGAAGCTAATGCTCGAGCATTAGCTTCCTACATATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-395s1c1
Sequence:CCGGCCAGCAGTACAGTTTGGCATTCTCGAGAATGCCAAACTGTACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-2866s1c1
Sequence:CCGGCCTGACTTTGAAGTTGCTTTACTCGAGTAAAGCAACTTCAAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008615.1-173s1c1
Sequence:CCGGGCAGTTGAACATTCATGGATTCTCGAGAATCCATGAATGTTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-1605s1c1
Sequence:CCGGGCAGTAAAGATTGTGCAAGATCTCGAGATCTTGCACAATCTTTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008615.1-843s1c1
Sequence:CCGGCGAAACAAGTATTGCACATTTCTCGAGAAATGTGCAATACTTGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002395
VALIDATED
ME1 MISSION shRNA Bacterial Glycerol Stock
malic enzyme 1, NADP(+)-dependent, cytosolic
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-615s1c1
Sequence:CCGGCCTGTGGGTAAATTGGCTCTACTCGAGTAGAGCCAATTTACCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1140s1c1
Sequence:CCGGGCTTCCTTAACACAAGAGAAACTCGAGTTTCTCTTGTGTTAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002395.2-437s1c1
Sequence:CCGGCCAACAATATAGTTTGGTGTTCTCGAGAACACCAAACTATATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1551s1c1
Sequence:CCGGGCTGAGGTTATAGCTCAGCAACTCGAGTTGCTGAGCTATAACCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1293s1c1
Sequence:CCGGGCCTTCAATGAACGGCCTATTCTCGAGAATAGGCCGTTCATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002395
VALIDATED
ME1 MISSION shRNA shRNA Plasmid DNA
malic enzyme 1, NADP(+)-dependent, cytosolic
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-615s1c1
Sequence:CCGGCCTGTGGGTAAATTGGCTCTACTCGAGTAGAGCCAATTTACCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1140s1c1
Sequence:CCGGGCTTCCTTAACACAAGAGAAACTCGAGTTTCTCTTGTGTTAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002395.2-437s1c1
Sequence:CCGGCCAACAATATAGTTTGGTGTTCTCGAGAACACCAAACTATATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1551s1c1
Sequence:CCGGGCTGAGGTTATAGCTCAGCAACTCGAGTTGCTGAGCTATAACCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1293s1c1
Sequence:CCGGGCCTTCAATGAACGGCCTATTCTCGAGAATAGGCCGTTCATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002395
VALIDATED
ME1 MISSION shRNA Lentiviral Transduction Particles
malic enzyme 1, NADP(+)-dependent, cytosolic
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-615s1c1
Sequence:CCGGCCTGTGGGTAAATTGGCTCTACTCGAGTAGAGCCAATTTACCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1140s1c1
Sequence:CCGGGCTTCCTTAACACAAGAGAAACTCGAGTTTCTCTTGTGTTAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002395.2-437s1c1
Sequence:CCGGCCAACAATATAGTTTGGTGTTCTCGAGAACACCAAACTATATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1551s1c1
Sequence:CCGGGCTGAGGTTATAGCTCAGCAACTCGAGTTGCTGAGCTATAACCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002395.2-1293s1c1
Sequence:CCGGGCCTTCAATGAACGGCCTATTCTCGAGAATAGGCCGTTCATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)