EMAIL THIS PAGE TO A FRIEND

ME3

malic enzyme 3, NADP(+)-dependent, mitochondrial

56 Gene Product Result for
Synonyms: NADP-ME
UniProtKB ID: Q16798
Gene ID:
Human(10873) Summary: Malic enzyme catalyzes the oxidative decarboxylation of malate to pyruvate using either NAD+ or NADP+ as a cofactor. Mammalian tissues contain 3 distinct isoforms of malic enzyme: a cytosolic NADP(+)-dependent isoform, a mitochondrial NADP(+)-dependent isoform, and a mitochondrial NAD(+)-dependent isoform. This gene encodes a mitochondrial NADP(+)-dependent isoform. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(109264) malic enzyme 3, NADP(+)-dependent, mitochondrial
Rat(361602) malic enzyme 3, NADP(+)-dependent, mitochondrial
Zebrafish(492719) malic enzyme 3, NADP(+)-dependent, mitochondrial
cow(525813) malic enzyme 3, NADP(+)-dependent, mitochondrial
Horse(100061008) malic enzyme 3, NADP(+)-dependent, mitochondrial
domestic cat(101094204) malic enzyme 3, NADP(+)-dependent, mitochondrial
dog(485151) malic enzyme 3, NADP(+)-dependent, mitochondrial
chicken(419019) malic enzyme 3, NADP(+)-dependent, mitochondrial
sheep(101102434) malic enzyme 3, NADP(+)-dependent, mitochondrial
domestic guinea pig(100715507) malic enzyme 3, NADP(+)-dependent, mitochondrial
naked mole-rat(101702308) malic enzyme 3, NADP(+)-dependent, mitochondrial
Domestic Rabbit(100342604) malic enzyme 3, NADP(+)-dependent, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48511 Anti-ME3 antibody produced in rabbit affinity isolated antibody zebrafish, bovine, human, rat, canine, rabbit, guinea pig, mouse
western blot pricing
HPA038473 Anti-ME3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4500171 Anti-ME3 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071381 MISSION® esiRNA esiRNA human ME3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014811 Rosetta Predictions human pricing
NM_006680 Rosetta Predictions human pricing
NM_001108491 Rosetta Predictions rat pricing
NM_181407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061601 predicted 1263
2 SASI_Hs01_00061602 predicted 477
3 SASI_Hs01_00061603 predicted 1137
4 SASI_Hs01_00061604 predicted 729
5 SASI_Hs01_00061605 predicted 1893
6 SASI_Hs01_00061606 predicted 1898
7 SASI_Hs01_00061607 predicted 1364
8 SASI_Hs01_00061608 predicted 1953
9 SASI_Hs01_00061609 predicted 1010
10 SASI_Hs01_00061610 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118476 predicted 1112
2 SASI_Hs01_00118477 predicted 323
3 SASI_Hs01_00118478 predicted 980
4 SASI_Hs01_00118479 predicted 577
5 SASI_Hs01_00118481 predicted 1734
6 SASI_Hs01_00118482 predicted 1740
7 SASI_Hs01_00118483 predicted 1210
8 SASI_Hs01_00118484 predicted 1799
9 SASI_Hs01_00118485 predicted 863
10 SASI_Hs02_00342084 predicted 926
11 SASI_Hs01_00118480 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239169 predicted 662
2 SASI_Rn02_00239170 predicted 558
3 SASI_Rn02_00239171 predicted 935
4 SASI_Rn02_00239172 predicted 344
5 SASI_Rn02_00239173 predicted 686
6 SASI_Rn02_00239174 predicted 790
7 SASI_Rn02_00239175 predicted 829
8 SASI_Rn02_00239176 predicted 497
9 SASI_Rn02_00239177 predicted 823
10 SASI_Rn02_00239178 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196047 predicted 1764
2 SASI_Mm01_00196048 predicted 972
3 SASI_Mm01_00196049 predicted 1982
4 SASI_Mm01_00196050 predicted 1733
5 SASI_Mm02_00349756 predicted 1069
6 SASI_Mm01_00196051 predicted 788
7 SASI_Mm01_00196053 predicted 907
8 SASI_Mm01_00196054 predicted 1551
9 SASI_Mm01_00196055 predicted 1881
10 SASI_Mm01_00196056 predicted 1610
11 SASI_Mm01_00196052 predicted 1846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006680
VALIDATED
ME3 MISSION shRNA Bacterial Glycerol Stock
malic enzyme 3, NADP(+)-dependent, mitochondrial
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006680.2-1919s21c1
Sequence:CCGGGCAGTCTCAGAGGCTAGTATGCTCGAGCATACTAGCCTCTGAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006680.2-318s21c1
Sequence:CCGGGCTTGGAATCCACGGCCTAATCTCGAGATTAGGCCGTGGATTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-902s1c1
Sequence:CCGGGCTCAACAAATACCGTAACAACTCGAGTTGTTACGGTATTTGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-302s1c1
Sequence:CCGGCCTCCGAATCATGAGATATTACTCGAGTAATATCTCATGATTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-1774s1c1
Sequence:CCGGCTCCAGACTATGACTCCTTTACTCGAGTAAAGGAGTCATAGTCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-1661s1c1
Sequence:CCGGCGTGTCTTTGAGAATTGCCATCTCGAGATGGCAATTCTCAAAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-498s1c1
Sequence:CCGGCGTGGACTGTTCATCACCATTCTCGAGAATGGTGATGAACAGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006680
VALIDATED
ME3 MISSION shRNA shRNA Plasmid DNA
malic enzyme 3, NADP(+)-dependent, mitochondrial
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006680.2-1919s21c1
Sequence:CCGGGCAGTCTCAGAGGCTAGTATGCTCGAGCATACTAGCCTCTGAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006680.2-318s21c1
Sequence:CCGGGCTTGGAATCCACGGCCTAATCTCGAGATTAGGCCGTGGATTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-902s1c1
Sequence:CCGGGCTCAACAAATACCGTAACAACTCGAGTTGTTACGGTATTTGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-302s1c1
Sequence:CCGGCCTCCGAATCATGAGATATTACTCGAGTAATATCTCATGATTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-1774s1c1
Sequence:CCGGCTCCAGACTATGACTCCTTTACTCGAGTAAAGGAGTCATAGTCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-1661s1c1
Sequence:CCGGCGTGTCTTTGAGAATTGCCATCTCGAGATGGCAATTCTCAAAGACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-498s1c1
Sequence:CCGGCGTGGACTGTTCATCACCATTCTCGAGAATGGTGATGAACAGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006680
VALIDATED
ME3 MISSION shRNA Lentiviral Transduction Particles
malic enzyme 3, NADP(+)-dependent, mitochondrial
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006680.2-1919s21c1
Sequence:CCGGGCAGTCTCAGAGGCTAGTATGCTCGAGCATACTAGCCTCTGAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006680.2-318s21c1
Sequence:CCGGGCTTGGAATCCACGGCCTAATCTCGAGATTAGGCCGTGGATTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-902s1c1
Sequence:CCGGGCTCAACAAATACCGTAACAACTCGAGTTGTTACGGTATTTGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-302s1c1
Sequence:CCGGCCTCCGAATCATGAGATATTACTCGAGTAATATCTCATGATTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-1774s1c1
Sequence:CCGGCTCCAGACTATGACTCCTTTACTCGAGTAAAGGAGTCATAGTCTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006680.1-1661s1c1
Sequence:CCGGCGTGTCTTTGAGAATTGCCATCTCGAGATGGCAATTCTCAAAGACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006680.1-498s1c1
Sequence:CCGGCGTGGACTGTTCATCACCATTCTCGAGAATGGTGATGAACAGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181407
ME3 MISSION shRNA Bacterial Glycerol Stock
malic enzyme 3, NADP(+)-dependent, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181407.2-2650s1c1
Sequence:CCGGCCCGTTAGATTTAATGTCTAACTCGAGTTAGACATTAAATCTAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-789s1c1
Sequence:CCGGCCAACAATGAGGAGCTTCTTACTCGAGTAAGAAGCTCCTCATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-904s1c1
Sequence:CCGGGTTCGGAATAAATTGCCTCATCTCGAGATGAGGCAATTTATTCCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-1739s1c1
Sequence:CCGGGCAGTCAAAGTCCTCGACTATCTCGAGATAGTCGAGGACTTTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-891s1c1
Sequence:CCGGCGGTGACAGATAAGTTCGGAACTCGAGTTCCGAACTTATCTGTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181407
ME3 MISSION shRNA shRNA Plasmid DNA
malic enzyme 3, NADP(+)-dependent, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181407.2-2650s1c1
Sequence:CCGGCCCGTTAGATTTAATGTCTAACTCGAGTTAGACATTAAATCTAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-789s1c1
Sequence:CCGGCCAACAATGAGGAGCTTCTTACTCGAGTAAGAAGCTCCTCATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-904s1c1
Sequence:CCGGGTTCGGAATAAATTGCCTCATCTCGAGATGAGGCAATTTATTCCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-1739s1c1
Sequence:CCGGGCAGTCAAAGTCCTCGACTATCTCGAGATAGTCGAGGACTTTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-891s1c1
Sequence:CCGGCGGTGACAGATAAGTTCGGAACTCGAGTTCCGAACTTATCTGTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181407
ME3 MISSION shRNA Lentiviral Transduction Particles
malic enzyme 3, NADP(+)-dependent, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114871    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181407.2-2650s1c1
Sequence:CCGGCCCGTTAGATTTAATGTCTAACTCGAGTTAGACATTAAATCTAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-789s1c1
Sequence:CCGGCCAACAATGAGGAGCTTCTTACTCGAGTAAGAAGCTCCTCATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-904s1c1
Sequence:CCGGGTTCGGAATAAATTGCCTCATCTCGAGATGAGGCAATTTATTCCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-1739s1c1
Sequence:CCGGGCAGTCAAAGTCCTCGACTATCTCGAGATAGTCGAGGACTTTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181407.2-891s1c1
Sequence:CCGGCGGTGACAGATAAGTTCGGAACTCGAGTTCCGAACTTATCTGTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)