EMAIL THIS PAGE TO A FRIEND

MEA1

male-enhanced antigen 1

64 Gene Product Result for
Synonyms: HYS MEA
UniProtKB ID: Q16626, Q5TC36, Q9BV01
Gene ID:
Mouse(17256) male enhanced antigen 1
Rat(685131) male-enhanced antigen 1
sheep(101111668) male-enhanced antigen 1
naked mole-rat(101726376) male-enhanced antigen 1
domestic guinea pig(100717111) male-enhanced antigen 1
Zebrafish(415201) male-enhanced antigen 1
dog(474906) male-enhanced antigen 1
cow(282462) male-enhanced antigen 1
domestic cat(101084286) male-enhanced antigen 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014623 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014623 Rosetta Predictions human pricing
NM_001044286 Rosetta Predictions rat pricing
NM_010787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112604 predicted 427
2 SASI_Hs01_00112605 predicted 562
3 SASI_Hs01_00112606 predicted 424
4 SASI_Hs01_00112607 predicted 630
5 SASI_Hs01_00112608 predicted 635
6 SASI_Hs01_00112609 predicted 620
7 SASI_Hs01_00112610 predicted 636
8 SASI_Hs01_00112611 predicted 557
9 SASI_Hs01_00112612 predicted 287
10 SASI_Hs01_00112613 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044286 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205534 predicted 450
2 SASI_Rn02_00205535 predicted 542
3 SASI_Rn02_00205536 predicted 268
4 SASI_Rn02_00205537 predicted 372
5 SASI_Rn02_00205538 predicted 570
6 SASI_Rn02_00205539 predicted 374
7 SASI_Rn02_00205540 predicted 605
8 SASI_Rn02_00205541 predicted 520
9 SASI_Rn02_00205542 predicted 378
10 SASI_Rn02_00205543 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038242 predicted 544
2 SASI_Mm01_00038246 predicted 261
3 SASI_Mm01_00038247 predicted 268
4 SASI_Mm01_00038248 predicted 291
5 SASI_Mm01_00038249 predicted 523
6 SASI_Mm01_00038250 predicted 541
7 SASI_Mm01_00038251 predicted 410
8 SASI_Mm02_00319355 predicted 567
9 SASI_Mm02_00319356 predicted 286
10 SASI_Mm02_00319357 predicted 616
11 SASI_Mm01_00038243 predicted 618
12 SASI_Mm01_00038244 predicted 453
13 SASI_Mm01_00038245 predicted 602
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010787
VALIDATED
MEA1 MISSION shRNA Bacterial Glycerol Stock
male-enhanced antigen 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-453s1c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-658s1c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-192s1c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-545s1c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010787.1-375s1c1
Sequence:CCGGCCTCCATTGGAGAGTGAGGATCTCGAGATCCTCACTCTCCAATGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-545s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-658s21c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-453s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-192s21c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-420s21c1
Sequence:CCGGTTGAGCAGCCACAGCTCTATCCTCGAGGATAGAGCTGTGGCTGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010787
VALIDATED
MEA1 MISSION shRNA shRNA Plasmid DNA
male-enhanced antigen 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-453s1c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-658s1c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-192s1c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-545s1c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010787.1-375s1c1
Sequence:CCGGCCTCCATTGGAGAGTGAGGATCTCGAGATCCTCACTCTCCAATGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-545s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-658s21c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-453s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-192s21c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-420s21c1
Sequence:CCGGTTGAGCAGCCACAGCTCTATCCTCGAGGATAGAGCTGTGGCTGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010787
VALIDATED
MEA1 MISSION shRNA Lentiviral Transduction Particles
male-enhanced antigen 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-453s1c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-658s1c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-192s1c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010787.1-545s1c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010787.1-375s1c1
Sequence:CCGGCCTCCATTGGAGAGTGAGGATCTCGAGATCCTCACTCTCCAATGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-545s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-658s21c1
Sequence:CCGGGACTAACAACTCTGGTCTTAACTCGAGTTAAGACCAGAGTTGTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-453s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-192s21c1
Sequence:CCGGAGCAGTGAAGAACCCGAGGAACTCGAGTTCCTCGGGTTCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010787.1-420s21c1
Sequence:CCGGTTGAGCAGCCACAGCTCTATCCTCGAGGATAGAGCTGTGGCTGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014623
VALIDATED
MEA1 MISSION shRNA Bacterial Glycerol Stock
male-enhanced antigen 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000139708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-350s1c1
Sequence:CCGGCATTTGCCAGACCCACCATTACTCGAGTAATGGTGGGTCTGGCAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-251s1c1
Sequence:CCGGCTGAACCAAGATCCTGAACAACTCGAGTTGTTCAGGATCTTGGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-78s1c1
Sequence:CCGGCAACAGTAGTTCTAGGAGGAGCTCGAGCTCCTCCTAGAACTACTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.1-405s1c1
Sequence:CCGGCGTTGAACAACCACAGCTCTACTCGAGTAGAGCTGTGGTTGTTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.2-680s1c1
Sequence:CCGGCTGAACACATCCCTGGTTGTACTCGAGTACAACCAGGGATGTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-426s21c1
Sequence:CCGGAGGGAGCTACAGCGTTGAACACTCGAGTGTTCAACGCTGTAGCTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-347s21c1
Sequence:CCGGGCTGACATCCAGGATCGAATCCTCGAGGATTCGATCCTGGATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-565s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-473s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-137s21c1
Sequence:CCGGATGGGCCCTGAGCGTATCTTCCTCGAGGAAGATACGCTCAGGGCCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-377s1c1
Sequence:CCGGGAAGATGAAGATGAGGAGGGACTCGAGTCCCTCCTCATCTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-250s1c1
Sequence:CCGGCCTGAACCAAGATCCTGAACACTCGAGTGTTCAGGATCTTGGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014623
VALIDATED
MEA1 MISSION shRNA shRNA Plasmid DNA
male-enhanced antigen 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000139708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-350s1c1
Sequence:CCGGCATTTGCCAGACCCACCATTACTCGAGTAATGGTGGGTCTGGCAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-251s1c1
Sequence:CCGGCTGAACCAAGATCCTGAACAACTCGAGTTGTTCAGGATCTTGGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-78s1c1
Sequence:CCGGCAACAGTAGTTCTAGGAGGAGCTCGAGCTCCTCCTAGAACTACTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.1-405s1c1
Sequence:CCGGCGTTGAACAACCACAGCTCTACTCGAGTAGAGCTGTGGTTGTTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.2-680s1c1
Sequence:CCGGCTGAACACATCCCTGGTTGTACTCGAGTACAACCAGGGATGTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-426s21c1
Sequence:CCGGAGGGAGCTACAGCGTTGAACACTCGAGTGTTCAACGCTGTAGCTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-347s21c1
Sequence:CCGGGCTGACATCCAGGATCGAATCCTCGAGGATTCGATCCTGGATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-565s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-473s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-137s21c1
Sequence:CCGGATGGGCCCTGAGCGTATCTTCCTCGAGGAAGATACGCTCAGGGCCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-377s1c1
Sequence:CCGGGAAGATGAAGATGAGGAGGGACTCGAGTCCCTCCTCATCTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-250s1c1
Sequence:CCGGCCTGAACCAAGATCCTGAACACTCGAGTGTTCAGGATCTTGGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014623
VALIDATED
MEA1 MISSION shRNA Lentiviral Transduction Particles
male-enhanced antigen 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000139708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-350s1c1
Sequence:CCGGCATTTGCCAGACCCACCATTACTCGAGTAATGGTGGGTCTGGCAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-251s1c1
Sequence:CCGGCTGAACCAAGATCCTGAACAACTCGAGTTGTTCAGGATCTTGGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-78s1c1
Sequence:CCGGCAACAGTAGTTCTAGGAGGAGCTCGAGCTCCTCCTAGAACTACTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.1-405s1c1
Sequence:CCGGCGTTGAACAACCACAGCTCTACTCGAGTAGAGCTGTGGTTGTTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014623.2-680s1c1
Sequence:CCGGCTGAACACATCCCTGGTTGTACTCGAGTACAACCAGGGATGTGTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-426s21c1
Sequence:CCGGAGGGAGCTACAGCGTTGAACACTCGAGTGTTCAACGCTGTAGCTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-347s21c1
Sequence:CCGGGCTGACATCCAGGATCGAATCCTCGAGGATTCGATCCTGGATGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-565s21c1
Sequence:CCGGGTGGGAAGATGTGGTACAGAACTCGAGTTCTGTACCACATCTTCCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-473s21c1
Sequence:CCGGGAACATGTAGAGCTGGTGAAACTCGAGTTTCACCAGCTCTACATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014623.2-137s21c1
Sequence:CCGGATGGGCCCTGAGCGTATCTTCCTCGAGGAAGATACGCTCAGGGCCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-377s1c1
Sequence:CCGGGAAGATGAAGATGAGGAGGGACTCGAGTCCCTCCTCATCTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014623.1-250s1c1
Sequence:CCGGCCTGAACCAAGATCCTGAACACTCGAGTGTTCAGGATCTTGGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)