EMAIL THIS PAGE TO A FRIEND

MEAF6

MYST/Esa1-associated factor 6

149 Gene Product Result for
Synonyms: C1orf149 CENP-28 EAF6 NY-SAR-91
UniProtKB ID: Q9HAF1, B1AK64, Q4F967, Q7Z311, Q86WE3
Gene ID:
Human(64769) Summary: This gene encodes a nuclear protein involved in transcriptional activation. The encoded protein may form a component of several different histone acetyltransferase complexes. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(70088) MYST/Esa1-associated factor 6
Rat(362594) MYST/Esa1-associated factor 6
Zebrafish(445300) MYST/Esa1-associated factor 6
cow(540599) MYST/Esa1-associated factor 6
domestic cat(101088598) MYST/Esa1-associated factor 6
dog(475331) MYST/Esa1-associated factor 6
chicken(419617) MYST/Esa1-associated factor 6
domestic guinea pig(100729649) MYST/Esa1-associated factor 6
naked mole-rat(101696387) MYST/Esa1-associated factor 6
sheep(101118579) MYST/Esa1-associated factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022756 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049951 MISSION® esiRNA esiRNA human C1orf149 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022756 Rosetta Predictions human pricing
XM_001057055 Rosetta Predictions rat pricing
XM_342912 Rosetta Predictions rat pricing
NM_027310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233602 predicted 386
2 SASI_Hs01_00233603 predicted 747
3 SASI_Hs01_00233604 predicted 361
4 SASI_Hs01_00233605 predicted 388
5 SASI_Hs01_00233607 predicted 366
6 SASI_Hs01_00233608 predicted 736
7 SASI_Hs01_00233609 predicted 550
8 SASI_Hs01_00233610 predicted 326
9 SASI_Hs02_00356014 predicted 470
10 SASI_Hs02_00356015 predicted 701
11 SASI_Hs01_00233601 predicted 673
12 SASI_Hs01_00233606 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285221 predicted 322
2 SASI_Rn02_00285222 predicted 270
3 SASI_Rn02_00285223 predicted 234
4 SASI_Rn02_00285224 predicted 240
5 SASI_Rn02_00285225 predicted 268
6 SASI_Rn02_00285226 predicted 192
7 SASI_Rn02_00285227 predicted 232
8 SASI_Rn02_00285228 predicted 349
9 SASI_Rn02_00285229 predicted 432
10 SASI_Rn02_00285230 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395021 predicted 270
2 SASI_Rn02_00395022 predicted 606
3 SASI_Rn02_00395023 predicted 565
4 SASI_Rn02_00395024 predicted 688
5 SASI_Rn02_00395025 predicted 297
6 SASI_Rn02_00395026 predicted 385
7 SASI_Rn02_00395027 predicted 302
8 SASI_Rn02_00395028 predicted 631
9 SASI_Rn02_00395029 predicted 655
10 SASI_Rn02_00395030 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051777 predicted 209
2 SASI_Mm01_00051779 predicted 381
3 SASI_Mm01_00051780 predicted 398
4 SASI_Mm01_00051781 predicted 388
5 SASI_Mm01_00051782 predicted 284
6 SASI_Mm01_00051783 predicted 393
7 SASI_Mm01_00051784 predicted 455
8 SASI_Mm02_00331937 predicted 207
9 SASI_Mm01_00051785 predicted 457
10 SASI_Mm01_00051786 predicted 202
11 SASI_Mm01_00051778 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027310
VALIDATED
MEAF6 MISSION shRNA Bacterial Glycerol Stock
MYST/Esa1-associated factor 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-664s21c1
Sequence:CCGGAGTAGAACCCAAGGTCCATTGCTCGAGCAATGGACCTTGGGTTCTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-701s21c1
Sequence:CCGGATATCTGCCATTCTCTTGTTTCTCGAGAAACAAGAGAATGGCAGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-408s1c1
Sequence:CCGGCAGACTTCCACAATCAGGAAACTCGAGTTTCCTGATTGTGGAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-637s1c1
Sequence:CCGGCACACCTCTGATTCTGTGTTACTCGAGTAACACAGAATCAGAGGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-173s1c1
Sequence:CCGGCTGGAAGACACTCAGATGTATCTCGAGATACATCTGAGTGTCTTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-292s1c1
Sequence:CCGGGCTCTTCAGCAAATCCTCAGTCTCGAGACTGAGGATTTGCTGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-211s1c1
Sequence:CCGGCTGGGATCGGTATTTGACCAACTCGAGTTGGTCAAATACCGATCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-172s1c1
Sequence:CCGGCCTGGAAGACACTCAGATGTACTCGAGTACATCTGAGTGTCTTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027310
VALIDATED
MEAF6 MISSION shRNA shRNA Plasmid DNA
MYST/Esa1-associated factor 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-664s21c1
Sequence:CCGGAGTAGAACCCAAGGTCCATTGCTCGAGCAATGGACCTTGGGTTCTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-701s21c1
Sequence:CCGGATATCTGCCATTCTCTTGTTTCTCGAGAAACAAGAGAATGGCAGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-408s1c1
Sequence:CCGGCAGACTTCCACAATCAGGAAACTCGAGTTTCCTGATTGTGGAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-637s1c1
Sequence:CCGGCACACCTCTGATTCTGTGTTACTCGAGTAACACAGAATCAGAGGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-173s1c1
Sequence:CCGGCTGGAAGACACTCAGATGTATCTCGAGATACATCTGAGTGTCTTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-292s1c1
Sequence:CCGGGCTCTTCAGCAAATCCTCAGTCTCGAGACTGAGGATTTGCTGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-211s1c1
Sequence:CCGGCTGGGATCGGTATTTGACCAACTCGAGTTGGTCAAATACCGATCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-172s1c1
Sequence:CCGGCCTGGAAGACACTCAGATGTACTCGAGTACATCTGAGTGTCTTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027310
VALIDATED
MEAF6 MISSION shRNA Lentiviral Transduction Particles
MYST/Esa1-associated factor 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-664s21c1
Sequence:CCGGAGTAGAACCCAAGGTCCATTGCTCGAGCAATGGACCTTGGGTTCTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027310.3-701s21c1
Sequence:CCGGATATCTGCCATTCTCTTGTTTCTCGAGAAACAAGAGAATGGCAGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-408s1c1
Sequence:CCGGCAGACTTCCACAATCAGGAAACTCGAGTTTCCTGATTGTGGAAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-637s1c1
Sequence:CCGGCACACCTCTGATTCTGTGTTACTCGAGTAACACAGAATCAGAGGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-173s1c1
Sequence:CCGGCTGGAAGACACTCAGATGTATCTCGAGATACATCTGAGTGTCTTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027310.1-292s1c1
Sequence:CCGGGCTCTTCAGCAAATCCTCAGTCTCGAGACTGAGGATTTGCTGAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-211s1c1
Sequence:CCGGCTGGGATCGGTATTTGACCAACTCGAGTTGGTCAAATACCGATCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_027310.1-172s1c1
Sequence:CCGGCCTGGAAGACACTCAGATGTACTCGAGTACATCTGAGTGTCTTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022756
VALIDATED
MEAF6 MISSION shRNA Bacterial Glycerol Stock
MYST/Esa1-associated factor 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-333s21c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022756.4-995s21c1
Sequence:CCGGAGTAGAACACAAGTCACATTTCTCGAGAAATGTGACTTGTGTTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-169s21c1
Sequence:CCGGCTCAGATGTATGGCAATATTACTCGAGTAATATTGCCATACATCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-104s21c1
Sequence:CCGGGGCGGAAACATTGGCAAATTTCTCGAGAAATTTGCCAATGTTTCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-243s21c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-244s1c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-746s1c1
Sequence:CCGGGCCTGTGACTTTGAGTAGTTTCTCGAGAAACTACTCAAAGTCACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-280s1c1
Sequence:CCGGCTCTTCAGTAAATCCTCGGTTCTCGAGAACCGAGGATTTACTGAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022756.3-334s1c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022756.3-1679s1c1
Sequence:CCGGGCTGAGGAATCTGCTAGTAATCTCGAGATTACTAGCAGATTCCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022756.3-316s1c1
Sequence:CCGGGTAAGTGCATTGGCAGGAGTTCTCGAGAACTCCTGCCAATGCACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022756
VALIDATED
MEAF6 MISSION shRNA shRNA Plasmid DNA
MYST/Esa1-associated factor 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-333s21c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022756.4-995s21c1
Sequence:CCGGAGTAGAACACAAGTCACATTTCTCGAGAAATGTGACTTGTGTTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-169s21c1
Sequence:CCGGCTCAGATGTATGGCAATATTACTCGAGTAATATTGCCATACATCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-104s21c1
Sequence:CCGGGGCGGAAACATTGGCAAATTTCTCGAGAAATTTGCCAATGTTTCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-243s21c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-244s1c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-746s1c1
Sequence:CCGGGCCTGTGACTTTGAGTAGTTTCTCGAGAAACTACTCAAAGTCACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-280s1c1
Sequence:CCGGCTCTTCAGTAAATCCTCGGTTCTCGAGAACCGAGGATTTACTGAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022756.3-334s1c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022756.3-1679s1c1
Sequence:CCGGGCTGAGGAATCTGCTAGTAATCTCGAGATTACTAGCAGATTCCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022756.3-316s1c1
Sequence:CCGGGTAAGTGCATTGGCAGGAGTTCTCGAGAACTCCTGCCAATGCACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022756
VALIDATED
MEAF6 MISSION shRNA Lentiviral Transduction Particles
MYST/Esa1-associated factor 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-333s21c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022756.4-995s21c1
Sequence:CCGGAGTAGAACACAAGTCACATTTCTCGAGAAATGTGACTTGTGTTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-169s21c1
Sequence:CCGGCTCAGATGTATGGCAATATTACTCGAGTAATATTGCCATACATCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-104s21c1
Sequence:CCGGGGCGGAAACATTGGCAAATTTCTCGAGAAATTTGCCAATGTTTCCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022756.4-243s21c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-244s1c1
Sequence:CCGGGATCGAAGGAACCGGAAGTTTCTCGAGAAACTTCCGGTTCCTTCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-746s1c1
Sequence:CCGGGCCTGTGACTTTGAGTAGTTTCTCGAGAAACTACTCAAAGTCACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_022756.3-280s1c1
Sequence:CCGGCTCTTCAGTAAATCCTCGGTTCTCGAGAACCGAGGATTTACTGAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022756.3-334s1c1
Sequence:CCGGGTTCAGGACCAGCTCATTGAACTCGAGTTCAATGAGCTGGTCCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022756.3-1679s1c1
Sequence:CCGGGCTGAGGAATCTGCTAGTAATCTCGAGATTACTAGCAGATTCCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129565    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022756.3-316s1c1
Sequence:CCGGGTAAGTGCATTGGCAGGAGTTCTCGAGAACTCCTGCCAATGCACTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)