EMAIL THIS PAGE TO A FRIEND

MECOM

MDS1 and EVI1 complex locus

100 Gene Product Result for
Synonyms: AML1-EVI-1 EVI1 MDS1 MDS1-EVI1 PRDM3
UniProtKB ID: Q13465, Q13466, Q6FH90
Gene ID:
Human(2122) Summary: The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(14013) MDS1 and EVI1 complex locus
Rat(294924) MDS1 and EVI1 complex locus
Zebrafish(497407) MDS1 and EVI1 complex locus
cow(532209) MDS1 and EVI1 complex locus
dog(488148) MDS1 and EVI1 complex locus
Horse(100057450) MDS1 and EVI1 complex locus
domestic cat(101088775) MDS1 and EVI1 complex locus
chicken(424997) MDS1 and EVI1 complex locus
sheep(101121055) MDS1 and EVI1 complex locus
naked mole-rat(101718355) MDS1 and EVI1 complex locus
domestic guinea pig(100727638) MDS1 and EVI1 complex locus
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005241 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005241 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005241 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090781 MISSION® esiRNA esiRNA human EVI1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105077 Rosetta Predictions human pricing
NM_001105078 Rosetta Predictions human pricing
NM_005241 Rosetta Predictions human pricing
NM_001106423 Rosetta Predictions rat pricing
NM_007963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323864 predicted 360
2 SASI_Hs02_00323865 predicted 2722
3 SASI_Hs02_00323866 predicted 2763
4 SASI_Hs02_00323867 predicted 962
5 SASI_Hs02_00323868 predicted 326
6 SASI_Hs02_00323869 predicted 1844
7 SASI_Hs02_00323870 predicted 3011
8 SASI_Hs02_00323871 predicted 2465
9 SASI_Hs02_00323872 predicted 1908
10 SASI_Hs02_00323873 predicted 3187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323874 predicted 1249
2 SASI_Hs02_00323875 predicted 3621
3 SASI_Hs02_00323876 predicted 3655
4 SASI_Hs02_00323877 predicted 1859
5 SASI_Hs02_00323878 predicted 1225
6 SASI_Hs02_00323879 predicted 2738
7 SASI_Hs02_00323880 predicted 3908
8 SASI_Hs02_00323881 predicted 3363
9 SASI_Hs02_00323882 predicted 2803
10 SASI_Hs02_00323883 predicted 4082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051058 predicted 291
2 SASI_Hs01_00051059 predicted 2663
3 SASI_Hs02_00339246 predicted 2696
4 SASI_Hs01_00051060 predicted 900
5 SASI_Hs01_00051061 predicted 259
6 SASI_Hs01_00051062 predicted 1783
7 SASI_Hs02_00339247 predicted 2955
8 SASI_Hs01_00051064 predicted 2399
9 SASI_Hs01_00051065 predicted 1842
10 SASI_Hs02_00339248 predicted 3124
11 SASI_Hs01_00051063 predicted 2984
12 SASI_Hs01_00051066 predicted 1182
13 SASI_Hs01_00051067 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218818 predicted 3977
2 SASI_Rn02_00218819 predicted 2066
3 SASI_Rn02_00218820 predicted 4016
4 SASI_Rn02_00218821 predicted 1581
5 SASI_Rn02_00218822 predicted 2521
6 SASI_Rn02_00218823 predicted 2644
7 SASI_Rn02_00218824 predicted 4109
8 SASI_Rn02_00218825 predicted 3269
9 SASI_Rn02_00218826 predicted 2271
10 SASI_Rn02_00218827 predicted 3399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021844 predicted 1989
2 SASI_Mm01_00021845 predicted 2815
3 SASI_Mm01_00021846 predicted 627
4 SASI_Mm01_00021847 predicted 2857
5 SASI_Mm01_00021848 predicted 407
6 SASI_Mm01_00021849 predicted 1279
7 SASI_Mm01_00021850 predicted 1386
8 SASI_Mm01_00021851 predicted 2425
9 SASI_Mm02_00312848 predicted 593
10 SASI_Mm01_00021852 predicted 1511
11 SASI_Mm01_00021853 predicted 2235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007963
VALIDATED
MECOM MISSION shRNA Bacterial Glycerol Stock
MDS1 and EVI1 complex locus
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1885s1c1
Sequence:CCGGCCCATTTATAGAGTAGAGAAACTCGAGTTTCTCTACTCTATAAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1578s1c1
Sequence:CCGGCCAATCACCAAGTGAAGTTAACTCGAGTTAACTTCACTTGGTGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1577s1c1
Sequence:CCGGCCCAATCACCAAGTGAAGTTACTCGAGTAACTTCACTTGGTGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2773s1c1
Sequence:CCGGCCGGTGAGGTATAAAGAGGAACTCGAGTTCCTCTTTATACCTCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2231s1c1
Sequence:CCGGGCAAATACTGTGATAGATCATCTCGAGATGATCTATCACAGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-305s21c1
Sequence:CCGGTTAACTGGAAGTCCAATTTAACTCGAGTTAAATTGGACTTCCAGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007963.1-2472s21c1
Sequence:CCGGCTTTACAGAGATCCGCAATTTCTCGAGAAATTGCGGATCTCTGTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1390s21c1
Sequence:GTACCGGATAAAGGCTATTGCGTCTATTCTCGAGAATAGACGCAATAGCCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-401s21c1
Sequence:CCGGGCAACCTTCAGCGACACATTCCTCGAGGAATGTGTCGCTGAAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1517s21c1
Sequence:CCGGCTCAATCAATGTACCCATTTCCTCGAGGAAATGGGTACATTGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007963
VALIDATED
MECOM MISSION shRNA shRNA Plasmid DNA
MDS1 and EVI1 complex locus
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1885s1c1
Sequence:CCGGCCCATTTATAGAGTAGAGAAACTCGAGTTTCTCTACTCTATAAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1578s1c1
Sequence:CCGGCCAATCACCAAGTGAAGTTAACTCGAGTTAACTTCACTTGGTGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1577s1c1
Sequence:CCGGCCCAATCACCAAGTGAAGTTACTCGAGTAACTTCACTTGGTGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2773s1c1
Sequence:CCGGCCGGTGAGGTATAAAGAGGAACTCGAGTTCCTCTTTATACCTCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2231s1c1
Sequence:CCGGGCAAATACTGTGATAGATCATCTCGAGATGATCTATCACAGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-305s21c1
Sequence:CCGGTTAACTGGAAGTCCAATTTAACTCGAGTTAAATTGGACTTCCAGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007963.1-2472s21c1
Sequence:CCGGCTTTACAGAGATCCGCAATTTCTCGAGAAATTGCGGATCTCTGTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1390s21c1
Sequence:GTACCGGATAAAGGCTATTGCGTCTATTCTCGAGAATAGACGCAATAGCCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-401s21c1
Sequence:CCGGGCAACCTTCAGCGACACATTCCTCGAGGAATGTGTCGCTGAAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1517s21c1
Sequence:CCGGCTCAATCAATGTACCCATTTCCTCGAGGAAATGGGTACATTGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007963
VALIDATED
MECOM MISSION shRNA Lentiviral Transduction Particles
MDS1 and EVI1 complex locus
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1885s1c1
Sequence:CCGGCCCATTTATAGAGTAGAGAAACTCGAGTTTCTCTACTCTATAAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1578s1c1
Sequence:CCGGCCAATCACCAAGTGAAGTTAACTCGAGTTAACTTCACTTGGTGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-1577s1c1
Sequence:CCGGCCCAATCACCAAGTGAAGTTACTCGAGTAACTTCACTTGGTGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2773s1c1
Sequence:CCGGCCGGTGAGGTATAAAGAGGAACTCGAGTTCCTCTTTATACCTCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007963.1-2231s1c1
Sequence:CCGGGCAAATACTGTGATAGATCATCTCGAGATGATCTATCACAGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-305s21c1
Sequence:CCGGTTAACTGGAAGTCCAATTTAACTCGAGTTAAATTGGACTTCCAGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007963.1-2472s21c1
Sequence:CCGGCTTTACAGAGATCCGCAATTTCTCGAGAAATTGCGGATCTCTGTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1390s21c1
Sequence:GTACCGGATAAAGGCTATTGCGTCTATTCTCGAGAATAGACGCAATAGCCTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-401s21c1
Sequence:CCGGGCAACCTTCAGCGACACATTCCTCGAGGAATGTGTCGCTGAAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007963.1-1517s21c1
Sequence:CCGGCTCAATCAATGTACCCATTTCCTCGAGGAAATGGGTACATTGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005241
VALIDATED
MECOM MISSION shRNA Bacterial Glycerol Stock
MDS1 and EVI1 complex locus
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005241.x-3043s1c1
Sequence:CCGGCCGGAGGATGACTATGAAGAACTCGAGTTCTTCATAGTCATCCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-3261s1c1
Sequence:CCGGGCCGTTACACAGAAAGTCCAACTCGAGTTGGACTTTCTGTGTAACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005241.x-3524s1c1
Sequence:CCGGTGCAGGGTCACTCATCTAAAGCTCGAGCTTTAGATGAGTGACCCTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-2167s1c1
Sequence:CCGGCCTTTCTTTATGGACCCTATTCTCGAGAATAGGGTCCATAAAGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-947s1c1
Sequence:CCGGGCACTACGTCTTCCTTAAATACTCGAGTATTTAAGGAAGACGTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005241
VALIDATED
MECOM MISSION shRNA shRNA Plasmid DNA
MDS1 and EVI1 complex locus
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005241.x-3043s1c1
Sequence:CCGGCCGGAGGATGACTATGAAGAACTCGAGTTCTTCATAGTCATCCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-3261s1c1
Sequence:CCGGGCCGTTACACAGAAAGTCCAACTCGAGTTGGACTTTCTGTGTAACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005241.x-3524s1c1
Sequence:CCGGTGCAGGGTCACTCATCTAAAGCTCGAGCTTTAGATGAGTGACCCTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-2167s1c1
Sequence:CCGGCCTTTCTTTATGGACCCTATTCTCGAGAATAGGGTCCATAAAGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-947s1c1
Sequence:CCGGGCACTACGTCTTCCTTAAATACTCGAGTATTTAAGGAAGACGTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005241
VALIDATED
MECOM MISSION shRNA Lentiviral Transduction Particles
MDS1 and EVI1 complex locus
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005241.x-3043s1c1
Sequence:CCGGCCGGAGGATGACTATGAAGAACTCGAGTTCTTCATAGTCATCCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-3261s1c1
Sequence:CCGGGCCGTTACACAGAAAGTCCAACTCGAGTTGGACTTTCTGTGTAACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005241.x-3524s1c1
Sequence:CCGGTGCAGGGTCACTCATCTAAAGCTCGAGCTTTAGATGAGTGACCCTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-2167s1c1
Sequence:CCGGCCTTTCTTTATGGACCCTATTCTCGAGAATAGGGTCCATAAAGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005241.x-947s1c1
Sequence:CCGGGCACTACGTCTTCCTTAAATACTCGAGTATTTAAGGAAGACGTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)