EMAIL THIS PAGE TO A FRIEND

MECP2

methyl CpG binding protein 2 (Rett syndrome)

443 Gene Product Result for
Synonyms: AUTSX3 MRX16 MRX79 MRXS13 MRXSL PPMX RS RTS RTT
UniProtKB ID: P51608, O15233, Q6QHH9, Q7Z384
Gene ID:
Human(4204) Summary: DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of mental retardation in females. [provided by RefSeq, Jul 2009]
Mouse(17257) methyl CpG binding protein 2
Rat(29386) methyl CpG binding protein 2
domestic guinea pig(100734864) methyl CpG binding protein 2 (Rett syndrome)
naked mole-rat(101700584) methyl CpG binding protein 2 (Rett syndrome)
Domestic Rabbit(100328751) methyl CpG binding protein 2 (Rett syndrome)
sheep(101121154) methyl CpG binding protein 2 (Rett syndrome)
Zebrafish(335250) methyl CpG binding protein 2
cow(539629) methyl CpG binding protein 2 (Rett syndrome)
domestic cat(101082385) methyl CpG binding protein 2 (Rett syndrome)
dog(612973) methyl CpG binding protein 2 (Rett syndrome)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101452 Anti-MECP2 (ab1) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, canine, human, horse, mouse, rat, rabbit
western blot pricing
SAB2101453 Anti-MECP2 (ab2) antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, horse, rat, human, mouse, rabbit, canine, yeast
western blot pricing
GW22665 Anti-MECP2 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
M9317 Anti-MeCP2 antibody produced in rabbit ~0.6 mg/mL, affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
SAB2108172 Anti-MECP2 antibody produced in rabbit affinity isolated antibody canine, yeast, human, horse, rabbit, guinea pig, mouse, rat
western blot pricing
HPA000593 Anti-MECP2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV43584 Anti-MECP2 antibody produced in rabbit IgG fraction of antiserum mouse, human, horse, rat, canine
western blot pricing
HPA001341 Anti-MECP2 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4800012 Imprint® Anti-MeCP2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ChIP, ELISA, western blot pricing
M6818 Monoclonal Anti-MeCP2 antibody produced in mouse clone Mec-168, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunocytochemistry, microarray, western blot pricing
M7443 Monoclonal Anti-MeCP2 antibody produced in mouse clone Men-8, purified immunoglobulin, buffered aqueous solution rat, monkey, human, mouse
ELISA, immunocytochemistry, microarray, western blot pricing
WH0004204M1 Monoclonal Anti-MECP2 antibody produced in mouse clone 4B6, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunohistochemistry, western blot pricing
SAB1404063 Monoclonal Anti-MECP2 antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110792 Rosetta Predictions human pricing
NM_004992 Rosetta Predictions human pricing
NM_022673 Rosetta Predictions rat pricing
NM_001081979 Rosetta Predictions mouse pricing
NM_010788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325035 predicted 956
2 SASI_Hs02_00325036 predicted 537
3 SASI_Hs02_00325037 predicted 490
4 SASI_Hs02_00325038 predicted 535
5 SASI_Hs02_00325039 predicted 410
6 SASI_Hs02_00325040 predicted 507
7 SASI_Hs02_00325041 predicted 484
8 SASI_Hs02_00325042 predicted 496
9 SASI_Hs02_00325043 predicted 961
10 SASI_Hs02_00325044 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116141 predicted 1086
2 SASI_Hs01_00116142 predicted 660
3 SASI_Hs01_00116143 predicted 617
4 SASI_Hs01_00116144 predicted 632
5 SASI_Hs02_00338714 predicted 613
6 SASI_Hs01_00116145 predicted 1076
7 SASI_Hs01_00116147 predicted 868
8 SASI_Hs02_00338715 predicted 1228
9 SASI_Hs02_00338716 predicted 1437
10 SASI_Hs02_00338717 predicted 1307
11 SASI_Hs01_00116140 predicted 522
12 SASI_Hs01_00116146 predicted 682
13 SASI_Hs01_00116148 predicted 350
14 SASI_Hs01_00116149 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072926 predicted 603
2 SASI_Rn01_00072927 predicted 604
3 SASI_Rn02_00263450 predicted 394
4 SASI_Rn01_00072929 predicted 511
5 SASI_Rn02_00263451 predicted 355
6 SASI_Rn02_00263452 predicted 561
7 SASI_Rn01_00072930 predicted 544
8 SASI_Rn01_00072931 predicted 728
9 SASI_Rn01_00072932 predicted 613
10 SASI_Rn01_00072934 predicted 1140
11 SASI_Rn01_00072928 predicted 452
12 SASI_Rn01_00072933 predicted 453
13 SASI_Rn01_00072935 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299182 predicted 399
2 SASI_Mm02_00299183 predicted 339
3 SASI_Mm02_00299184 predicted 953
4 SASI_Mm02_00299185 predicted 408
5 SASI_Mm02_00299186 predicted 1418
6 SASI_Mm02_00299187 predicted 607
7 SASI_Mm02_00299188 predicted 955
8 SASI_Mm02_00299189 predicted 1396
9 SASI_Mm02_00299190 predicted 492
10 SASI_Mm02_00299191 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082740 predicted 480
2 SASI_Mm01_00082741 predicted 423
3 SASI_Mm01_00082743 predicted 1035
4 SASI_Mm01_00082744 predicted 489
5 SASI_Mm01_00082745 predicted 1501
6 SASI_Mm01_00082746 predicted 690
7 SASI_Mm02_00319358 predicted 1038
8 SASI_Mm01_00082747 predicted 1477
9 SASI_Mm01_00082748 predicted 573
10 SASI_Mm02_00319359 predicted 1466
11 SASI_Mm01_00082742 predicted 535
12 SASI_Mm01_00082749 predicted 326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004992
VALIDATED
MECP2 MISSION shRNA Bacterial Glycerol Stock
methyl CpG binding protein 2 (Rett syndrome)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-585s21c1
Sequence:GTACCGGATGATGTGTATTTGATCAATCCTCGAGGATTGATCAAATACACATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-666s21c1
Sequence:CCGGACACATCCCTGGACCCTAATGCTCGAGCATTAGGGTCCAGGGATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004992.3-1766s21c1
Sequence:CCGGTGACAAAGCTTCCCGATTAACCTCGAGGTTAATCGGGAAGCTTTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004992.3-1593s21c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1459s21c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1085s21c1
Sequence:GTACCGGGCCGTGAAGGAGTCTTCTATCCTCGAGGATAGAAGACTCCTTCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-739s21c1
Sequence:GTACCGGACCACCTAAGAAGCCCAAATCCTCGAGGATTTGGGCTTCTTAGGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-564s1c1
Sequence:CCGGCGCTCTAAAGTGGAGTTGATTCTCGAGAATCAACTCCACTTTAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-272s1c1
Sequence:CCGGGAAAGAAGAGAAAGAGGGCAACTCGAGTTGCCCTCTTTCTCTTCTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1400s1c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-517s1c1
Sequence:CCGGCTGGGAAGTATGATGTGTATTCTCGAGAATACACATCATACTTCCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1534s1c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004992
VALIDATED
MECP2 MISSION shRNA shRNA Plasmid DNA
methyl CpG binding protein 2 (Rett syndrome)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-585s21c1
Sequence:GTACCGGATGATGTGTATTTGATCAATCCTCGAGGATTGATCAAATACACATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-666s21c1
Sequence:CCGGACACATCCCTGGACCCTAATGCTCGAGCATTAGGGTCCAGGGATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004992.3-1766s21c1
Sequence:CCGGTGACAAAGCTTCCCGATTAACCTCGAGGTTAATCGGGAAGCTTTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004992.3-1593s21c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1459s21c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1085s21c1
Sequence:GTACCGGGCCGTGAAGGAGTCTTCTATCCTCGAGGATAGAAGACTCCTTCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-739s21c1
Sequence:GTACCGGACCACCTAAGAAGCCCAAATCCTCGAGGATTTGGGCTTCTTAGGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-564s1c1
Sequence:CCGGCGCTCTAAAGTGGAGTTGATTCTCGAGAATCAACTCCACTTTAGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-272s1c1
Sequence:CCGGGAAAGAAGAGAAAGAGGGCAACTCGAGTTGCCCTCTTTCTCTTCTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1400s1c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-517s1c1
Sequence:CCGGCTGGGAAGTATGATGTGTATTCTCGAGAATACACATCATACTTCCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1534s1c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004992
VALIDATED
MECP2 MISSION shRNA Lentiviral Transduction Particles
methyl CpG binding protein 2 (Rett syndrome)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-585s21c1
Sequence:GTACCGGATGATGTGTATTTGATCAATCCTCGAGGATTGATCAAATACACATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-666s21c1
Sequence:CCGGACACATCCCTGGACCCTAATGCTCGAGCATTAGGGTCCAGGGATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004992.3-1766s21c1
Sequence:CCGGTGACAAAGCTTCCCGATTAACCTCGAGGTTAATCGGGAAGCTTTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004992.3-1593s21c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1459s21c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-1085s21c1
Sequence:GTACCGGGCCGTGAAGGAGTCTTCTATCCTCGAGGATAGAAGACTCCTTCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004992.3-739s21c1
Sequence:GTACCGGACCACCTAAGAAGCCCAAATCCTCGAGGATTTGGGCTTCTTAGGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-564s1c1
Sequence:CCGGCGCTCTAAAGTGGAGTTGATTCTCGAGAATCAACTCCACTTTAGAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-272s1c1
Sequence:CCGGGAAAGAAGAGAAAGAGGGCAACTCGAGTTGCCCTCTTTCTCTTCTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1400s1c1
Sequence:CCGGCGTCTGCAAAGAGGAGAAGATCTCGAGATCTTCTCCTCTTTGCAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-517s1c1
Sequence:CCGGCTGGGAAGTATGATGTGTATTCTCGAGAATACACATCATACTTCCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004992.2-1534s1c1
Sequence:CCGGGAGAGCGCAAAGACATTGTTTCTCGAGAAACAATGTCTTTGCGCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010788
VALIDATED
MECP2 MISSION shRNA Bacterial Glycerol Stock
methyl CpG binding protein 2 (Rett syndrome)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1266s21c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-830s21c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-579s21c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010788.3-531s21c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1715s21c1
Sequence:CCGGCTGACAAAGCTTCCCGATTAACTCGAGTTAATCGGGAAGCTTTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1549s1c1
Sequence:CCGGGCAAAGACATTGTTTCATCTTCTCGAGAAGATGAAACAATGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-531s1c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-830s1c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1266s1c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-579s1c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010788
VALIDATED
MECP2 MISSION shRNA shRNA Plasmid DNA
methyl CpG binding protein 2 (Rett syndrome)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1266s21c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-830s21c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-579s21c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010788.3-531s21c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1715s21c1
Sequence:CCGGCTGACAAAGCTTCCCGATTAACTCGAGTTAATCGGGAAGCTTTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1549s1c1
Sequence:CCGGGCAAAGACATTGTTTCATCTTCTCGAGAAGATGAAACAATGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-531s1c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-830s1c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1266s1c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-579s1c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010788
VALIDATED
MECP2 MISSION shRNA Lentiviral Transduction Particles
methyl CpG binding protein 2 (Rett syndrome)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1266s21c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-830s21c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-579s21c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010788.3-531s21c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010788.3-1715s21c1
Sequence:CCGGCTGACAAAGCTTCCCGATTAACTCGAGTTAATCGGGAAGCTTTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1549s1c1
Sequence:CCGGGCAAAGACATTGTTTCATCTTCTCGAGAAGATGAAACAATGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-531s1c1
Sequence:CCGGGCTGGAAAGTATGATGTATATCTCGAGATATACATCATACTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-830s1c1
Sequence:CCGGCCCTGGGAAACTTGTTGTCAACTCGAGTTGACAACAAGTTTCCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-1266s1c1
Sequence:CCGGCCTAAGAAGGAGCACCATCATCTCGAGATGATGGTGCTCCTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010788.1-579s1c1
Sequence:CCGGCGCTCTAAAGTAGAATTGATTCTCGAGAATCAATTCTACTTTAGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)