EMAIL THIS PAGE TO A FRIEND

MECR

mitochondrial trans-2-enoyl-CoA reductase

74 Gene Product Result for
Synonyms: CGI-63 FASN2B NRBF1
Gene ID:
Mouse(26922) mitochondrial trans-2-enoyl-CoA reductase
Rat(29470) mitochondrial trans-2-enoyl-CoA reductase
Zebrafish(550550) mitochondrial trans-2-enoyl-CoA reductase
domestic cat(101092129) mitochondrial trans-2-enoyl-CoA reductase
cow(353301) mitochondrial trans-2-enoyl-CoA reductase
Horse(100070598) mitochondrial trans-2-enoyl-CoA reductase
dog(478159) mitochondrial trans-2-enoyl-CoA reductase
chicken(419601) mitochondrial trans-2-enoyl-CoA reductase
sheep(101121831) mitochondrial trans-2-enoyl-CoA reductase
naked mole-rat(101724669) mitochondrial trans-2-enoyl-CoA reductase
domestic guinea pig(100715702) mitochondrial trans-2-enoyl-CoA reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016011 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024732 Rosetta Predictions human pricing
NM_016011 Rosetta Predictions human pricing
NM_017209 Rosetta Predictions rat pricing
NM_025297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160778 predicted 1439
2 SASI_Hs01_00160779 predicted 991
3 SASI_Hs01_00160780 predicted 875
4 SASI_Hs01_00160781 predicted 1222
5 SASI_Hs01_00160782 predicted 589
6 SASI_Hs01_00160783 predicted 783
7 SASI_Hs01_00160785 predicted 619
8 SASI_Hs01_00160786 predicted 1372
9 SASI_Hs02_00307243 predicted 667
10 SASI_Hs02_00307244 predicted 1502
11 SASI_Hs01_00160784 predicted 1264
12 SASI_Hs01_00160787 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165676 predicted 1311
2 SASI_Hs01_00165677 predicted 863
3 SASI_Hs01_00165678 predicted 755
4 SASI_Hs01_00165679 predicted 1090
5 SASI_Hs01_00165680 predicted 470
6 SASI_Hs01_00165681 predicted 652
7 SASI_Hs01_00165683 predicted 492
8 SASI_Hs01_00165684 predicted 1240
9 SASI_Hs02_00348690 predicted 547
10 SASI_Hs02_00348691 predicted 1372
11 SASI_Hs01_00165682 predicted 1142
12 SASI_Hs01_00165685 predicted 1284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017209 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046045 predicted 529
2 SASI_Rn01_00046046 predicted 220
3 SASI_Rn01_00046048 predicted 253
4 SASI_Rn01_00046049 predicted 433
5 SASI_Rn01_00046050 predicted 637
6 SASI_Rn01_00046051 predicted 690
7 SASI_Rn01_00046052 predicted 990
8 SASI_Rn01_00046053 predicted 392
9 SASI_Rn01_00046054 predicted 206
10 SASI_Rn02_00261569 predicted 335
11 SASI_Rn01_00046047 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119189 predicted 537
2 SASI_Mm01_00119190 predicted 266
3 SASI_Mm01_00119191 predicted 472
4 SASI_Mm01_00119192 predicted 656
5 SASI_Mm01_00119193 predicted 815
6 SASI_Mm01_00119194 predicted 450
7 SASI_Mm01_00119195 predicted 698
8 SASI_Mm01_00119196 predicted 447
9 SASI_Mm02_00327913 predicted 546
10 SASI_Mm01_00119197 predicted 743
11 SASI_Mm01_00119188 predicted 735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025297
VALIDATED
MECR MISSION shRNA Bacterial Glycerol Stock
mitochondrial trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-165s1c1
Sequence:CCGGGCGCTGGTCTATGGCAACCATCTCGAGATGGTTGCCATAGACCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-916s1c1
Sequence:CCGGCCTCTGTGAGTCTGCTCATTTCTCGAGAAATGAGCAGACTCACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-650s1c1
Sequence:CCGGCCTTCGCTTAAAGACCATCAACTCGAGTTGATGGTCTTTAAGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025297.1-687s1c1
Sequence:CCGGCCCGACATCAAGAAGCTAACTCTCGAGAGTTAGCTTCTTGATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-685s1c1
Sequence:CCGGGACCCGACATCAAGAAGCTAACTCGAGTTAGCTTCTTGATGTCGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025297
VALIDATED
MECR MISSION shRNA shRNA Plasmid DNA
mitochondrial trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-165s1c1
Sequence:CCGGGCGCTGGTCTATGGCAACCATCTCGAGATGGTTGCCATAGACCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-916s1c1
Sequence:CCGGCCTCTGTGAGTCTGCTCATTTCTCGAGAAATGAGCAGACTCACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-650s1c1
Sequence:CCGGCCTTCGCTTAAAGACCATCAACTCGAGTTGATGGTCTTTAAGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025297.1-687s1c1
Sequence:CCGGCCCGACATCAAGAAGCTAACTCTCGAGAGTTAGCTTCTTGATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-685s1c1
Sequence:CCGGGACCCGACATCAAGAAGCTAACTCGAGTTAGCTTCTTGATGTCGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025297
VALIDATED
MECR MISSION shRNA Lentiviral Transduction Particles
mitochondrial trans-2-enoyl-CoA reductase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-165s1c1
Sequence:CCGGGCGCTGGTCTATGGCAACCATCTCGAGATGGTTGCCATAGACCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-916s1c1
Sequence:CCGGCCTCTGTGAGTCTGCTCATTTCTCGAGAAATGAGCAGACTCACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-650s1c1
Sequence:CCGGCCTTCGCTTAAAGACCATCAACTCGAGTTGATGGTCTTTAAGCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025297.1-687s1c1
Sequence:CCGGCCCGACATCAAGAAGCTAACTCTCGAGAGTTAGCTTCTTGATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025297.1-685s1c1
Sequence:CCGGGACCCGACATCAAGAAGCTAACTCGAGTTAGCTTCTTGATGTCGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016011
VALIDATED
MECR MISSION shRNA Bacterial Glycerol Stock
mitochondrial trans-2-enoyl-CoA reductase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-280s21c1
Sequence:CCGGATCAATCCATCTGACATAAATCTCGAGATTTATGTCAGATGGATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-1115s1c1
Sequence:CCGGCTTCATATCTTCAAAGCAGATCTCGAGATCTGCTTTGAAGATATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016011.1-645s1c1
Sequence:CCGGCTGGGCCTAAGAACCATCAATCTCGAGATTGATGGTTCTTAGGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-266s1c1
Sequence:CCGGCCCTATCAATCCATCTGACATCTCGAGATGTCAGATGGATTGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-807s1c1
Sequence:CCGGCTCAACTGTGTTGGTGGGAAACTCGAGTTTCCCACCAACACAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016011.1-201s1c1
Sequence:CCGGGAACTCAAGAACCTGGAGCTACTCGAGTAGCTCCAGGTTCTTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-678s21c1
Sequence:CCGGGGTCCGAGACAGACCTGATATCTCGAGATATCAGGTCTGTCTCGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-757s21c1
Sequence:CCGGGAGCTAAGAAGGCCCGAAATGCTCGAGCATTTCGGGCCTTCTTAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-920s21c1
Sequence:CCGGCCTCTGTGAGCCTGCTCATTTCTCGAGAAATGAGCAGGCTCACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-1317s21c1
Sequence:CCGGGCCAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016011
VALIDATED
MECR MISSION shRNA shRNA Plasmid DNA
mitochondrial trans-2-enoyl-CoA reductase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-280s21c1
Sequence:CCGGATCAATCCATCTGACATAAATCTCGAGATTTATGTCAGATGGATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-1115s1c1
Sequence:CCGGCTTCATATCTTCAAAGCAGATCTCGAGATCTGCTTTGAAGATATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016011.1-645s1c1
Sequence:CCGGCTGGGCCTAAGAACCATCAATCTCGAGATTGATGGTTCTTAGGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-266s1c1
Sequence:CCGGCCCTATCAATCCATCTGACATCTCGAGATGTCAGATGGATTGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-807s1c1
Sequence:CCGGCTCAACTGTGTTGGTGGGAAACTCGAGTTTCCCACCAACACAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016011.1-201s1c1
Sequence:CCGGGAACTCAAGAACCTGGAGCTACTCGAGTAGCTCCAGGTTCTTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-678s21c1
Sequence:CCGGGGTCCGAGACAGACCTGATATCTCGAGATATCAGGTCTGTCTCGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-757s21c1
Sequence:CCGGGAGCTAAGAAGGCCCGAAATGCTCGAGCATTTCGGGCCTTCTTAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-920s21c1
Sequence:CCGGCCTCTGTGAGCCTGCTCATTTCTCGAGAAATGAGCAGGCTCACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-1317s21c1
Sequence:CCGGGCCAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016011
VALIDATED
MECR MISSION shRNA Lentiviral Transduction Particles
mitochondrial trans-2-enoyl-CoA reductase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-280s21c1
Sequence:CCGGATCAATCCATCTGACATAAATCTCGAGATTTATGTCAGATGGATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-1115s1c1
Sequence:CCGGCTTCATATCTTCAAAGCAGATCTCGAGATCTGCTTTGAAGATATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016011.1-645s1c1
Sequence:CCGGCTGGGCCTAAGAACCATCAATCTCGAGATTGATGGTTCTTAGGCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-266s1c1
Sequence:CCGGCCCTATCAATCCATCTGACATCTCGAGATGTCAGATGGATTGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_016011.1-807s1c1
Sequence:CCGGCTCAACTGTGTTGGTGGGAAACTCGAGTTTCCCACCAACACAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016011.1-201s1c1
Sequence:CCGGGAACTCAAGAACCTGGAGCTACTCGAGTAGCTCCAGGTTCTTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-678s21c1
Sequence:CCGGGGTCCGAGACAGACCTGATATCTCGAGATATCAGGTCTGTCTCGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-757s21c1
Sequence:CCGGGAGCTAAGAAGGCCCGAAATGCTCGAGCATTTCGGGCCTTCTTAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-920s21c1
Sequence:CCGGCCTCTGTGAGCCTGCTCATTTCTCGAGAAATGAGCAGGCTCACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245055    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016011.2-1317s21c1
Sequence:CCGGGCCAGCCTTAAGGTATCTAATCTCGAGATTAGATACCTTAAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)