EMAIL THIS PAGE TO A FRIEND

MED10

mediator complex subunit 10

53 Gene Product Result for
Synonyms: NUT2 TRG20
UniProtKB ID: Q9BTT4, C6G491
Gene ID:
Human(84246) Summary: MED10 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]
Mouse(28077) mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)
Rat(290939) mediator complex subunit 10
sheep(101102335) mediator complex subunit 10
naked mole-rat(101713439) mediator complex subunit 10
domestic guinea pig(100713153) mediator complex subunit 10
Zebrafish(550394) mediator of RNA polymerase II transcription, subunit 10 homolog
cow(614276) mediator complex subunit 10
domestic cat(101099357) mediator complex subunit 10
dog(607911) mediator complex subunit 10
chicken(420940) mediator complex subunit 10
fruit fly(39777) Mediator complex subunit 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032286 Rosetta Predictions human pricing
NM_001106097 Rosetta Predictions rat pricing
NM_138596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041058 predicted 206
2 SASI_Hs02_00359604 predicted 198
3 SASI_Hs01_00041059 predicted 645
4 SASI_Hs01_00041060 predicted 220
5 SASI_Hs01_00041061 predicted 389
6 SASI_Hs01_00041062 predicted 425
7 SASI_Hs01_00041063 predicted 389
8 SASI_Hs01_00041064 predicted 287
9 SASI_Hs01_00041066 predicted 336
10 SASI_Hs02_00359605 predicted 578
11 SASI_Hs01_00041057 predicted 210
12 SASI_Hs01_00041065 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215602 predicted 364
2 SASI_Rn02_00215603 predicted 220
3 SASI_Rn02_00215604 predicted 304
4 SASI_Rn02_00215605 predicted 293
5 SASI_Rn02_00215606 predicted 267
6 SASI_Rn02_00215607 predicted 365
7 SASI_Rn02_00215608 predicted 334
8 SASI_Rn02_00215609 predicted 483
9 SASI_Rn02_00215610 predicted 471
10 SASI_Rn02_00215611 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122340 predicted 463
2 SASI_Mm01_00122341 predicted 455
3 SASI_Mm02_00339663 predicted 333
4 SASI_Mm01_00122342 predicted 294
5 SASI_Mm01_00122343 predicted 459
6 SASI_Mm01_00122344 predicted 475
7 SASI_Mm01_00122345 predicted 208
8 SASI_Mm02_00339664 predicted 278
9 SASI_Mm01_00122346 predicted 363
10 SASI_Mm01_00122347 predicted 543
11 SASI_Mm01_00122348 predicted 378
12 SASI_Mm01_00122349 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032286
VALIDATED
MED10 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 10
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-203s21c1
Sequence:CCGGTGCAGACAGCAGCTTCATGATCTCGAGATCATGAAGCTGCTGTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-188s1c1
Sequence:CCGGCAGGATATTGACAAGTGCAGACTCGAGTCTGCACTTGTCAATATCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-322s1c1
Sequence:CCGGGCAAGTTAAAGGCAAGATCGACTCGAGTCGATCTTGCCTTTAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-248s1c1
Sequence:CCGGGAATATATAGATCAAGGTCGACTCGAGTCGACCTTGATCTATATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-380s1c1
Sequence:CCGGCTTTCTAAAGTATTTCCGGAACTCGAGTTCCGGAAATACTTTAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-176s1c1
Sequence:CCGGGTTACTGGCTTACAGGATATTCTCGAGAATATCCTGTAAGCCAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-219s21c1
Sequence:CCGGATGATATTACTGTACCGTTAGCTCGAGCTAACGGTACAGTAATATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-183s1c1
Sequence:CCGGGCTTACAGGATATTGACAAGTCTCGAGACTTGTCAATATCCTGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-845s1c1
Sequence:CCGGCCGAAAGCTAAATAACGACTACTCGAGTAGTCGTTATTTAGCTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-80s1c1
Sequence:CCGGGAGAAGTTCGTGGAGAACATTCTCGAGAATGTTCTCCACGAACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-579s1c1
Sequence:CCGGGTCCTCATTGTTTGGCCTCATCTCGAGATGAGGCCAAACAATGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-367s21c1
Sequence:CCGGGTTGATTCAAGAACTTTCTAACTCGAGTTAGAAAGTTCTTGAATCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-334s21c1
Sequence:CCGGCAAGATCGACACCATGAAGAACTCGAGTTCTTCATGGTGTCGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032286
VALIDATED
MED10 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 10
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-203s21c1
Sequence:CCGGTGCAGACAGCAGCTTCATGATCTCGAGATCATGAAGCTGCTGTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-188s1c1
Sequence:CCGGCAGGATATTGACAAGTGCAGACTCGAGTCTGCACTTGTCAATATCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-322s1c1
Sequence:CCGGGCAAGTTAAAGGCAAGATCGACTCGAGTCGATCTTGCCTTTAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-248s1c1
Sequence:CCGGGAATATATAGATCAAGGTCGACTCGAGTCGACCTTGATCTATATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-380s1c1
Sequence:CCGGCTTTCTAAAGTATTTCCGGAACTCGAGTTCCGGAAATACTTTAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-176s1c1
Sequence:CCGGGTTACTGGCTTACAGGATATTCTCGAGAATATCCTGTAAGCCAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-219s21c1
Sequence:CCGGATGATATTACTGTACCGTTAGCTCGAGCTAACGGTACAGTAATATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-183s1c1
Sequence:CCGGGCTTACAGGATATTGACAAGTCTCGAGACTTGTCAATATCCTGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-845s1c1
Sequence:CCGGCCGAAAGCTAAATAACGACTACTCGAGTAGTCGTTATTTAGCTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-80s1c1
Sequence:CCGGGAGAAGTTCGTGGAGAACATTCTCGAGAATGTTCTCCACGAACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-579s1c1
Sequence:CCGGGTCCTCATTGTTTGGCCTCATCTCGAGATGAGGCCAAACAATGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-367s21c1
Sequence:CCGGGTTGATTCAAGAACTTTCTAACTCGAGTTAGAAAGTTCTTGAATCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-334s21c1
Sequence:CCGGCAAGATCGACACCATGAAGAACTCGAGTTCTTCATGGTGTCGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032286
VALIDATED
MED10 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 10
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-203s21c1
Sequence:CCGGTGCAGACAGCAGCTTCATGATCTCGAGATCATGAAGCTGCTGTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-188s1c1
Sequence:CCGGCAGGATATTGACAAGTGCAGACTCGAGTCTGCACTTGTCAATATCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-322s1c1
Sequence:CCGGGCAAGTTAAAGGCAAGATCGACTCGAGTCGATCTTGCCTTTAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-248s1c1
Sequence:CCGGGAATATATAGATCAAGGTCGACTCGAGTCGACCTTGATCTATATATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032286.2-380s1c1
Sequence:CCGGCTTTCTAAAGTATTTCCGGAACTCGAGTTCCGGAAATACTTTAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-176s1c1
Sequence:CCGGGTTACTGGCTTACAGGATATTCTCGAGAATATCCTGTAAGCCAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-219s21c1
Sequence:CCGGATGATATTACTGTACCGTTAGCTCGAGCTAACGGTACAGTAATATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-183s1c1
Sequence:CCGGGCTTACAGGATATTGACAAGTCTCGAGACTTGTCAATATCCTGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-845s1c1
Sequence:CCGGCCGAAAGCTAAATAACGACTACTCGAGTAGTCGTTATTTAGCTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-80s1c1
Sequence:CCGGGAGAAGTTCGTGGAGAACATTCTCGAGAATGTTCTCCACGAACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032286.2-579s1c1
Sequence:CCGGGTCCTCATTGTTTGGCCTCATCTCGAGATGAGGCCAAACAATGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-367s21c1
Sequence:CCGGGTTGATTCAAGAACTTTCTAACTCGAGTTAGAAAGTTCTTGAATCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032286.2-334s21c1
Sequence:CCGGCAAGATCGACACCATGAAGAACTCGAGTTCTTCATGGTGTCGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138596
VALIDATED
MED10 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138596.2-711s21c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-343s21c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-347s1c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138596.1-198s1c1
Sequence:CCGGCAGGACATAGATAAATGCAGACTCGAGTCTGCATTTATCTATGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-372s1c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-715s1c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-162s1c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-158s21c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-368s21c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138596
VALIDATED
MED10 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138596.2-711s21c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-343s21c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-347s1c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138596.1-198s1c1
Sequence:CCGGCAGGACATAGATAAATGCAGACTCGAGTCTGCATTTATCTATGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-372s1c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-715s1c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-162s1c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-158s21c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-368s21c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138596
VALIDATED
MED10 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302059    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138596.2-711s21c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-343s21c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-347s1c1
Sequence:CCGGGATCGACACAATGAAGAAATTCTCGAGAATTTCTTCATTGTGTCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138596.1-198s1c1
Sequence:CCGGCAGGACATAGATAAATGCAGACTCGAGTCTGCATTTATCTATGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-372s1c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-715s1c1
Sequence:CCGGGCTCCTACTTGACATTTCCTTCTCGAGAAGGAAATGTCAAGTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138596.1-162s1c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-158s21c1
Sequence:CCGGCTGAGCCAGAAGCTAAACTTTCTCGAGAAAGTTTAGCTTCTGGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138596.2-368s21c1
Sequence:CCGGAGCCTACTGATTCAGGAACTTCTCGAGAAGTTCCTGAATCAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)