EMAIL THIS PAGE TO A FRIEND

MED11

mediator complex subunit 11

67 Gene Product Result for
UniProtKB ID: Q9P086, Q6NS89
Gene ID:
Human(400569) Summary: MED11 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]
Mouse(66172) mediator of RNA polymerase II transcription, subunit 11 homolog (S. cerevisiae)
Rat(287456) mediator complex subunit 11
Zebrafish(100148504) mediator complex subunit 11
domestic cat(101093153) mediator complex subunit 11
cow(511672) mediator complex subunit 11
dog(607526) mediator complex subunit 11
fruit fly(40042) Mediator complex subunit 11
domestic guinea pig(100720227) mediator complex subunit 11
naked mole-rat(101711223) mediator complex subunit 11
sheep(101111979) mediator complex subunit 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA056669 Anti-MED11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025397 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025397 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025397 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001683 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001683 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001683 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001683 Rosetta Predictions human pricing
NM_001105799 Rosetta Predictions rat pricing
NM_025397 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012001 predicted 356
2 SASI_Hs01_00012002 predicted 465
3 SASI_Hs01_00012003 predicted 491
4 SASI_Hs01_00012004 predicted 413
5 SASI_Hs01_00012006 predicted 213
6 SASI_Hs02_00303880 predicted 425
7 SASI_Hs01_00012007 predicted 381
8 SASI_Hs01_00012008 predicted 209
9 SASI_Hs02_00303881 predicted 209
10 SASI_Hs01_00012009 predicted 444
11 SASI_Hs01_00012005 predicted 591
12 SASI_Hs01_00012010 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212646 predicted 467
2 SASI_Rn02_00212647 predicted 326
3 SASI_Rn02_00212648 predicted 333
4 SASI_Rn02_00212649 predicted 317
5 SASI_Rn02_00212650 predicted 377
6 SASI_Rn02_00212651 predicted 394
7 SASI_Rn02_00212652 predicted 381
8 SASI_Rn02_00212653 predicted 394
9 SASI_Rn02_00212654 predicted 317
10 SASI_Rn02_00212655 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025397 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047634 predicted 454
2 SASI_Mm01_00047635 predicted 657
3 SASI_Mm01_00047636 predicted 412
4 SASI_Mm01_00047642 predicted 202
5 SASI_Mm01_00047637 predicted 364
6 SASI_Mm01_00047638 predicted 342
7 SASI_Mm01_00047639 predicted 336
8 SASI_Mm01_00047640 predicted 388
9 SASI_Mm02_00328150 predicted 306
10 SASI_Mm02_00328151 predicted 318
11 SASI_Mm01_00047641 predicted 411
12 SASI_Mm01_00047643 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025397
MED11 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 11
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-357s21c1
Sequence:CCGGGATTAGTGATGTGGCGAGAACCTCGAGGTTCTCGCCACATCACTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025397.2-659s1c1
Sequence:CCGGCAGAAGACTTGGCCCAATAAACTCGAGTTTATTGGGCCAAGTCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-228s21c1
Sequence:CCGGGGCAGAGCTATCCGCTCAAATCTCGAGATTTGAGCGGATAGCTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025397.2-658s21c1
Sequence:CCGGTCAGAAGACTTGGCCCAATAACTCGAGTTATTGGGCCAAGTCTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-312s21c1
Sequence:CCGGGGACTGTCAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGACAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-313s1c1
Sequence:CCGGGACTGTCAAATGGCTCTAAAGCTCGAGCTTTAGAGCCATTTGACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-319s1c1
Sequence:CCGGCAAATGGCTCTAAAGCGAGTACTCGAGTACTCGCTTTAGAGCCATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025397
MED11 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 11
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-357s21c1
Sequence:CCGGGATTAGTGATGTGGCGAGAACCTCGAGGTTCTCGCCACATCACTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025397.2-659s1c1
Sequence:CCGGCAGAAGACTTGGCCCAATAAACTCGAGTTTATTGGGCCAAGTCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-228s21c1
Sequence:CCGGGGCAGAGCTATCCGCTCAAATCTCGAGATTTGAGCGGATAGCTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025397.2-658s21c1
Sequence:CCGGTCAGAAGACTTGGCCCAATAACTCGAGTTATTGGGCCAAGTCTTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-312s21c1
Sequence:CCGGGGACTGTCAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGACAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-313s1c1
Sequence:CCGGGACTGTCAAATGGCTCTAAAGCTCGAGCTTTAGAGCCATTTGACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-319s1c1
Sequence:CCGGCAAATGGCTCTAAAGCGAGTACTCGAGTACTCGCTTTAGAGCCATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025397
MED11 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 11
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-357s21c1
Sequence:CCGGGATTAGTGATGTGGCGAGAACCTCGAGGTTCTCGCCACATCACTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025397.2-659s1c1
Sequence:CCGGCAGAAGACTTGGCCCAATAAACTCGAGTTTATTGGGCCAAGTCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-228s21c1
Sequence:CCGGGGCAGAGCTATCCGCTCAAATCTCGAGATTTGAGCGGATAGCTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025397.2-658s21c1
Sequence:CCGGTCAGAAGACTTGGCCCAATAACTCGAGTTATTGGGCCAAGTCTTCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025397.2-312s21c1
Sequence:CCGGGGACTGTCAAATGGCTCTAAACTCGAGTTTAGAGCCATTTGACAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179656    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-313s1c1
Sequence:CCGGGACTGTCAAATGGCTCTAAAGCTCGAGCTTTAGAGCCATTTGACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025397.2-319s1c1
Sequence:CCGGCAAATGGCTCTAAAGCGAGTACTCGAGTACTCGCTTTAGAGCCATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001683
MED11 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 11
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000180972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-134s1c1
Sequence:CCGGCCTTCAGAATGCAGGTACTGTCTCGAGACAGTACCTGCATTCTGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-659s1c1
Sequence:CCGGGAGGAGATGGAAACTGACATACTCGAGTATGTCAGTTTCCATCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-148s1c1
Sequence:CCGGGTACTGTGATCCTAGAATTGTCTCGAGACAATTCTAGGATCACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-686s1c1
Sequence:CCGGCCACTTCCTCAAACACTTCATCTCGAGATGAAGTGTTTGAGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001683
MED11 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 11
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000180972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-134s1c1
Sequence:CCGGCCTTCAGAATGCAGGTACTGTCTCGAGACAGTACCTGCATTCTGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-659s1c1
Sequence:CCGGGAGGAGATGGAAACTGACATACTCGAGTATGTCAGTTTCCATCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-148s1c1
Sequence:CCGGGTACTGTGATCCTAGAATTGTCTCGAGACAATTCTAGGATCACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-686s1c1
Sequence:CCGGCCACTTCCTCAAACACTTCATCTCGAGATGAAGTGTTTGAGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001683
MED11 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 11
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000180972    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-134s1c1
Sequence:CCGGCCTTCAGAATGCAGGTACTGTCTCGAGACAGTACCTGCATTCTGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-659s1c1
Sequence:CCGGGAGGAGATGGAAACTGACATACTCGAGTATGTCAGTTTCCATCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001683.1-148s1c1
Sequence:CCGGGTACTGTGATCCTAGAATTGTCTCGAGACAATTCTAGGATCACAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148559    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001683.1-686s1c1
Sequence:CCGGCCACTTCCTCAAACACTTCATCTCGAGATGAAGTGTTTGAGGAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)