EMAIL THIS PAGE TO A FRIEND

MED12

mediator complex subunit 12

78 Gene Product Result for
Synonyms: ARC240 CAGH45 FGS1 HOPA MED12S OHDOX OKS OPA1 TNRC11 TRAP230
UniProtKB ID: Q93074, O15410, O75557, Q9UHV6, Q9UND7
Gene ID:
Human(9968) Summary: The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009]
Mouse(59024) mediator of RNA polymerase II transcription, subunit 12 homolog (yeast)
Rat(679693) mediator complex subunit 12
sheep(101123015) mediator complex subunit 12
naked mole-rat(101714647) mediator complex subunit 12
Domestic Rabbit(100350850) mediator complex subunit 12
domestic guinea pig(100713106) mediator complex subunit 12
Zebrafish(566632) mediator of RNA polymerase II transcription, subunit 12 homolog
cow(520974) mediator complex subunit 12
Horse(100056909) mediator complex subunit 12
domestic cat(101090673) mediator complex subunit 12
dog(480952) mediator complex subunit 12
chicken(422210) mediator complex subunit 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005120 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005120 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005120 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005120 Rosetta Predictions human pricing
XM_001054608 Rosetta Predictions rat pricing
XM_001054666 Rosetta Predictions rat pricing
NM_021521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005120 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016177 predicted 6004
2 SASI_Hs01_00016178 predicted 2197
3 SASI_Hs01_00016179 predicted 1756
4 SASI_Hs01_00016181 predicted 1153
5 SASI_Hs01_00016182 predicted 491
6 SASI_Hs01_00016184 predicted 3655
7 SASI_Hs01_00016185 predicted 692
8 SASI_Hs01_00016186 predicted 3444
9 SASI_Hs02_00339020 predicted 4576
10 SASI_Hs02_00339021 predicted 2168
11 SASI_Hs01_00016180 predicted 2151
12 SASI_Hs01_00016183 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276460 predicted 3530
2 SASI_Rn02_00276461 predicted 728
3 SASI_Rn02_00276462 predicted 403
4 SASI_Rn02_00276463 predicted 5640
5 SASI_Rn02_00276464 predicted 5250
6 SASI_Rn02_00276465 predicted 3863
7 SASI_Rn02_00276466 predicted 662
8 SASI_Rn02_00276467 predicted 1080
9 SASI_Rn02_00276468 predicted 855
10 SASI_Rn02_00276469 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276727 predicted 3527
2 SASI_Rn02_00276728 predicted 728
3 SASI_Rn02_00276729 predicted 406
4 SASI_Rn02_00276730 predicted 5635
5 SASI_Rn02_00276731 predicted 5251
6 SASI_Rn02_00276732 predicted 3867
7 SASI_Rn02_00276733 predicted 656
8 SASI_Rn02_00276734 predicted 1085
9 SASI_Rn02_00276735 predicted 851
10 SASI_Rn02_00276736 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326247 predicted 400
2 SASI_Mm01_00086461 predicted 3304
3 SASI_Mm02_00326248 predicted 502
4 SASI_Mm01_00086462 predicted 1730
5 SASI_Mm01_00086463 predicted 5380
6 SASI_Mm01_00086464 predicted 1296
7 SASI_Mm01_00086465 predicted 1697
8 SASI_Mm01_00086466 predicted 1315
9 SASI_Mm01_00086467 predicted 655
10 SASI_Mm01_00086468 predicted 2472
11 SASI_Mm01_00086469 predicted 1376
12 SASI_Mm01_00086470 predicted 3151
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021521
VALIDATED
MED12 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 12
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-5489s1c1
Sequence:CCGGCCGTGCGATTACCAATGCAAACTCGAGTTTGCATTGGTAATCGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-2287s1c1
Sequence:CCGGGCTCCTATTGTGCCTCTGAATCTCGAGATTCAGAGGCACAATAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-625s1c1
Sequence:CCGGGCCTTGTTCATGTTTCAGGATCTCGAGATCCTGAAACATGAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-3583s1c1
Sequence:CCGGGCTGTGTTTGTACTCGGAGATCTCGAGATCTCCGAGTACAAACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-1808s1c1
Sequence:CCGGCCTCTCCCTTTGATGATCCTACTCGAGTAGGATCATCAAAGGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1991s21c1
Sequence:CCGGTGATGTCTTCTCCCATAATATCTCGAGATATTATGGGAGAAGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1318s21c1
Sequence:CCGGCATTGACTGATAGCCGAATTACTCGAGTAATTCGGCTATCAGTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021521.2-6935s21c1
Sequence:CCGGCTAGAGCTGCTGCACTCAATACTCGAGTATTGAGTGCAGCAGCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021521
VALIDATED
MED12 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 12
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-5489s1c1
Sequence:CCGGCCGTGCGATTACCAATGCAAACTCGAGTTTGCATTGGTAATCGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-2287s1c1
Sequence:CCGGGCTCCTATTGTGCCTCTGAATCTCGAGATTCAGAGGCACAATAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-625s1c1
Sequence:CCGGGCCTTGTTCATGTTTCAGGATCTCGAGATCCTGAAACATGAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-3583s1c1
Sequence:CCGGGCTGTGTTTGTACTCGGAGATCTCGAGATCTCCGAGTACAAACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-1808s1c1
Sequence:CCGGCCTCTCCCTTTGATGATCCTACTCGAGTAGGATCATCAAAGGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1991s21c1
Sequence:CCGGTGATGTCTTCTCCCATAATATCTCGAGATATTATGGGAGAAGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1318s21c1
Sequence:CCGGCATTGACTGATAGCCGAATTACTCGAGTAATTCGGCTATCAGTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021521.2-6935s21c1
Sequence:CCGGCTAGAGCTGCTGCACTCAATACTCGAGTATTGAGTGCAGCAGCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021521
VALIDATED
MED12 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 12
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-5489s1c1
Sequence:CCGGCCGTGCGATTACCAATGCAAACTCGAGTTTGCATTGGTAATCGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-2287s1c1
Sequence:CCGGGCTCCTATTGTGCCTCTGAATCTCGAGATTCAGAGGCACAATAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-625s1c1
Sequence:CCGGGCCTTGTTCATGTTTCAGGATCTCGAGATCCTGAAACATGAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021521.1-3583s1c1
Sequence:CCGGGCTGTGTTTGTACTCGGAGATCTCGAGATCTCCGAGTACAAACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021521.1-1808s1c1
Sequence:CCGGCCTCTCCCTTTGATGATCCTACTCGAGTAGGATCATCAAAGGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1991s21c1
Sequence:CCGGTGATGTCTTCTCCCATAATATCTCGAGATATTATGGGAGAAGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021521.2-1318s21c1
Sequence:CCGGCATTGACTGATAGCCGAATTACTCGAGTAATTCGGCTATCAGTCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363808    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021521.2-6935s21c1
Sequence:CCGGCTAGAGCTGCTGCACTCAATACTCGAGTATTGAGTGCAGCAGCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005120
VALIDATED
MED12 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-365s1c1
Sequence:CCGGGCAGCATTATTGCAGAGAAATCTCGAGATTTCTCTGCAATAATGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-1507s1c1
Sequence:CCGGCGGGTACTTCATACTTTGGAACTCGAGTTCCAAAGTATGAAGTACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-376s1c1
Sequence:CCGGGCAGAGAAATTACGTTGTAATCTCGAGATTACAACGTAATTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-3808s1c1
Sequence:CCGGGCTGTTCTCAAGGCTGTGTTTCTCGAGAAACACAGCCTTGAGAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6699s21c1
Sequence:CCGGCACAGCCCAGTACCAACATATCTCGAGATATGTTGGTACTGGGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-1509s21c1
Sequence:CCGGTTCGCTGGTCTTTCGATAAATCTCGAGATTTATCGAAAGACCAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-762s21c1
Sequence:CCGGAGATCATCACCAAGTACTTATCTCGAGATAAGTACTTGGTGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005120.2-3396s21c1
Sequence:CCGGATGATCCCGATAGGGTGAATGCTCGAGCATTCACCCTATCGGGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6770s21c1
Sequence:CCGGCCCACCCTTTCCTCTTAATTCCTCGAGGAATTAAGAGGAAAGGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005120
VALIDATED
MED12 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-365s1c1
Sequence:CCGGGCAGCATTATTGCAGAGAAATCTCGAGATTTCTCTGCAATAATGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-1507s1c1
Sequence:CCGGCGGGTACTTCATACTTTGGAACTCGAGTTCCAAAGTATGAAGTACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-376s1c1
Sequence:CCGGGCAGAGAAATTACGTTGTAATCTCGAGATTACAACGTAATTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-3808s1c1
Sequence:CCGGGCTGTTCTCAAGGCTGTGTTTCTCGAGAAACACAGCCTTGAGAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6699s21c1
Sequence:CCGGCACAGCCCAGTACCAACATATCTCGAGATATGTTGGTACTGGGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-1509s21c1
Sequence:CCGGTTCGCTGGTCTTTCGATAAATCTCGAGATTTATCGAAAGACCAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-762s21c1
Sequence:CCGGAGATCATCACCAAGTACTTATCTCGAGATAAGTACTTGGTGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005120.2-3396s21c1
Sequence:CCGGATGATCCCGATAGGGTGAATGCTCGAGCATTCACCCTATCGGGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6770s21c1
Sequence:CCGGCCCACCCTTTCCTCTTAATTCCTCGAGGAATTAAGAGGAAAGGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005120
VALIDATED
MED12 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-365s1c1
Sequence:CCGGGCAGCATTATTGCAGAGAAATCTCGAGATTTCTCTGCAATAATGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-1507s1c1
Sequence:CCGGCGGGTACTTCATACTTTGGAACTCGAGTTCCAAAGTATGAAGTACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-376s1c1
Sequence:CCGGGCAGAGAAATTACGTTGTAATCTCGAGATTACAACGTAATTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005120.1-3808s1c1
Sequence:CCGGGCTGTTCTCAAGGCTGTGTTTCTCGAGAAACACAGCCTTGAGAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6699s21c1
Sequence:CCGGCACAGCCCAGTACCAACATATCTCGAGATATGTTGGTACTGGGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-1509s21c1
Sequence:CCGGTTCGCTGGTCTTTCGATAAATCTCGAGATTTATCGAAAGACCAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-762s21c1
Sequence:CCGGAGATCATCACCAAGTACTTATCTCGAGATAAGTACTTGGTGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005120.2-3396s21c1
Sequence:CCGGATGATCCCGATAGGGTGAATGCTCGAGCATTCACCCTATCGGGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005120.2-6770s21c1
Sequence:CCGGCCCACCCTTTCCTCTTAATTCCTCGAGGAATTAAGAGGAAAGGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)