EMAIL THIS PAGE TO A FRIEND

MED13

mediator complex subunit 13

233 Gene Product Result for
Synonyms: ARC250 DRIP250 HSPC221 THRAP1 TRAP240
UniProtKB ID: Q9UHV7, B2RU05, O60334
Gene ID:
Human(9969) Summary: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
Mouse(327987) mediator complex subunit 13
Rat(303403) mediator complex subunit 13
sheep(101107616) mediator complex subunit 13
naked mole-rat(101726158) mediator complex subunit 13
Domestic Rabbit(100337925) mediator complex subunit 13
domestic guinea pig(100729262) mediator complex subunit 13
chicken(417639) mediator complex subunit 13
dog(480582) mediator complex subunit 13
cow(524868) mediator complex subunit 13
Horse(100071145) mediator complex subunit 13
domestic cat(101091826) mediator complex subunit 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005121 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005121 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005121 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU194311 MISSION® esiRNA esiRNA targeting mouse Med13 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005121 Rosetta Predictions human pricing
NM_001107035 Rosetta Predictions rat pricing
NM_001080931 Rosetta Predictions mouse pricing
XM_109726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005121 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339022 predicted 6264
2 SASI_Hs02_00339023 predicted 427
3 SASI_Hs01_00153505 predicted 4440
4 SASI_Hs01_00153506 predicted 4081
5 SASI_Hs01_00153507 predicted 3871
6 SASI_Hs01_00153508 predicted 443
7 SASI_Hs01_00153510 predicted 5716
8 SASI_Hs01_00153511 predicted 5547
9 SASI_Hs01_00153512 predicted 355
10 SASI_Hs01_00153513 predicted 4974
11 SASI_Hs01_00153509 predicted 4146
12 SASI_Hs01_00153514 predicted 5046
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224846 predicted 1430
2 SASI_Rn02_00224847 predicted 2263
3 SASI_Rn02_00224848 predicted 2833
4 SASI_Rn02_00224849 predicted 3976
5 SASI_Rn02_00224850 predicted 4133
6 SASI_Rn02_00224851 predicted 4916
7 SASI_Rn02_00224852 predicted 1071
8 SASI_Rn02_00224853 predicted 5387
9 SASI_Rn02_00224854 predicted 5566
10 SASI_Rn02_00224855 predicted 3359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294013 predicted 4202
2 SASI_Mm02_00294014 predicted 5629
3 SASI_Mm02_00294015 predicted 5464
4 SASI_Mm02_00294016 predicted 1264
5 SASI_Mm02_00294017 predicted 4356
6 SASI_Mm02_00294018 predicted 5702
7 SASI_Mm02_00294019 predicted 379
8 SASI_Mm02_00294020 predicted 323
9 SASI_Mm02_00294021 predicted 4952
10 SASI_Mm02_00294022 predicted 2765
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273100 predicted 4215
2 SASI_Mm01_00273101 predicted 5635
3 SASI_Mm01_00273102 predicted 5470
4 SASI_Mm01_00273103 predicted 1273
5 SASI_Mm01_00273104 predicted 4370
6 SASI_Mm01_00273105 predicted 5706
7 SASI_Mm01_00273106 predicted 382
8 SASI_Mm01_00273107 predicted 335
9 SASI_Mm01_00273108 predicted 4953
10 SASI_Mm01_00273109 predicted 3438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005121
VALIDATED
MED13 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005121.1-1610s1c1
Sequence:CCGGCCGAACTAATGATGTAGCAAACTCGAGTTTGCTACATCATTAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-462s1c1
Sequence:CCGGCGGTGTTTAATGAACAGGAATCTCGAGATTCCTGTTCATTAAACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-110s1c1
Sequence:CCGGCCTGGAAGATTGTCACTGTAACTCGAGTTACAGTGACAATCTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-5896s1c1
Sequence:CCGGCGACTCTAAATATGCAGACATCTCGAGATGTCTGCATATTTAGAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-4708s1c1
Sequence:CCGGCCAACTTGAATAGTGGAGTATCTCGAGATACTCCACTATTCAAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-2454s21c1
Sequence:CCGGGAACTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005121.2-4920s21c1
Sequence:CCGGAGCACGATGGATCGGGATAAACTCGAGTTTATCCCGATCCATCGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-7514s21c1
Sequence:CCGGGTTTAGGGCTATGACTAATATCTCGAGATATTAGTCATAGCCCTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-6230s21c1
Sequence:CCGGTCATGAGGAAGTACCTAATATCTCGAGATATTAGGTACTTCCTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-3653s21c1
Sequence:CCGGACAAGATCAGTGCACTAATTTCTCGAGAAATTAGTGCACTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005121
VALIDATED
MED13 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005121.1-1610s1c1
Sequence:CCGGCCGAACTAATGATGTAGCAAACTCGAGTTTGCTACATCATTAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-462s1c1
Sequence:CCGGCGGTGTTTAATGAACAGGAATCTCGAGATTCCTGTTCATTAAACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-110s1c1
Sequence:CCGGCCTGGAAGATTGTCACTGTAACTCGAGTTACAGTGACAATCTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-5896s1c1
Sequence:CCGGCGACTCTAAATATGCAGACATCTCGAGATGTCTGCATATTTAGAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-4708s1c1
Sequence:CCGGCCAACTTGAATAGTGGAGTATCTCGAGATACTCCACTATTCAAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-2454s21c1
Sequence:CCGGGAACTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005121.2-4920s21c1
Sequence:CCGGAGCACGATGGATCGGGATAAACTCGAGTTTATCCCGATCCATCGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-7514s21c1
Sequence:CCGGGTTTAGGGCTATGACTAATATCTCGAGATATTAGTCATAGCCCTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-6230s21c1
Sequence:CCGGTCATGAGGAAGTACCTAATATCTCGAGATATTAGGTACTTCCTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-3653s21c1
Sequence:CCGGACAAGATCAGTGCACTAATTTCTCGAGAAATTAGTGCACTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005121
VALIDATED
MED13 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_005121.1-1610s1c1
Sequence:CCGGCCGAACTAATGATGTAGCAAACTCGAGTTTGCTACATCATTAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-462s1c1
Sequence:CCGGCGGTGTTTAATGAACAGGAATCTCGAGATTCCTGTTCATTAAACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-110s1c1
Sequence:CCGGCCTGGAAGATTGTCACTGTAACTCGAGTTACAGTGACAATCTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-5896s1c1
Sequence:CCGGCGACTCTAAATATGCAGACATCTCGAGATGTCTGCATATTTAGAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005121.1-4708s1c1
Sequence:CCGGCCAACTTGAATAGTGGAGTATCTCGAGATACTCCACTATTCAAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-2454s21c1
Sequence:CCGGGAACTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005121.2-4920s21c1
Sequence:CCGGAGCACGATGGATCGGGATAAACTCGAGTTTATCCCGATCCATCGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-7514s21c1
Sequence:CCGGGTTTAGGGCTATGACTAATATCTCGAGATATTAGTCATAGCCCTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-6230s21c1
Sequence:CCGGTCATGAGGAAGTACCTAATATCTCGAGATATTAGGTACTTCCTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005121.2-3653s21c1
Sequence:CCGGACAAGATCAGTGCACTAATTTCTCGAGAAATTAGTGCACTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080931
VALIDATED
MED13 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 13
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-10935s21c1
Sequence:CCGGTCCCGTAGGCAGTGGTATAAACTCGAGTTTATACCACTGCCTACGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-5851s21c1
Sequence:CCGGGATACATCCTGTACTCATATACTCGAGTATATGAGTACAGGATGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-11582s21c1
Sequence:CCGGTAACGAATACAGGGAGTTAAACTCGAGTTTAACTCCCTGTATTCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2260s21c1
Sequence:CCGGGATGCTCCACGCCCTACAAATCTCGAGATTTGTAGGGCGTGGAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6142s21c1
Sequence:CCGGTCGCATGATGAAGTAACTAATCTCGAGATTAGTTACTTCATCATGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6008s21c1
Sequence:CCGGATCTTGATCCTGATATCATTACTCGAGTAATGATATCAGGATCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-398s21c1
Sequence:CCGGACCGAAACTTTGTACGAATTGCTCGAGCAATTCGTACAAAGTTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-3573s21c1
Sequence:CCGGACAAGATCAATGCACTAATTTCTCGAGAAATTAGTGCATTGATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2374s21c1
Sequence:GTACCGGGAATTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-1022s21c1
Sequence:CCGGCCGCACAGAAGTGGGTCAAATCTCGAGATTTGACCCACTTCTGTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080931
VALIDATED
MED13 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 13
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-10935s21c1
Sequence:CCGGTCCCGTAGGCAGTGGTATAAACTCGAGTTTATACCACTGCCTACGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-5851s21c1
Sequence:CCGGGATACATCCTGTACTCATATACTCGAGTATATGAGTACAGGATGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-11582s21c1
Sequence:CCGGTAACGAATACAGGGAGTTAAACTCGAGTTTAACTCCCTGTATTCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2260s21c1
Sequence:CCGGGATGCTCCACGCCCTACAAATCTCGAGATTTGTAGGGCGTGGAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6142s21c1
Sequence:CCGGTCGCATGATGAAGTAACTAATCTCGAGATTAGTTACTTCATCATGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6008s21c1
Sequence:CCGGATCTTGATCCTGATATCATTACTCGAGTAATGATATCAGGATCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-398s21c1
Sequence:CCGGACCGAAACTTTGTACGAATTGCTCGAGCAATTCGTACAAAGTTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-3573s21c1
Sequence:CCGGACAAGATCAATGCACTAATTTCTCGAGAAATTAGTGCATTGATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2374s21c1
Sequence:GTACCGGGAATTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-1022s21c1
Sequence:CCGGCCGCACAGAAGTGGGTCAAATCTCGAGATTTGACCCACTTCTGTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080931
VALIDATED
MED13 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 13
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-10935s21c1
Sequence:CCGGTCCCGTAGGCAGTGGTATAAACTCGAGTTTATACCACTGCCTACGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-5851s21c1
Sequence:CCGGGATACATCCTGTACTCATATACTCGAGTATATGAGTACAGGATGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080931.1-11582s21c1
Sequence:CCGGTAACGAATACAGGGAGTTAAACTCGAGTTTAACTCCCTGTATTCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2260s21c1
Sequence:CCGGGATGCTCCACGCCCTACAAATCTCGAGATTTGTAGGGCGTGGAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6142s21c1
Sequence:CCGGTCGCATGATGAAGTAACTAATCTCGAGATTAGTTACTTCATCATGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-6008s21c1
Sequence:CCGGATCTTGATCCTGATATCATTACTCGAGTAATGATATCAGGATCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-398s21c1
Sequence:CCGGACCGAAACTTTGTACGAATTGCTCGAGCAATTCGTACAAAGTTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-3573s21c1
Sequence:CCGGACAAGATCAATGCACTAATTTCTCGAGAAATTAGTGCATTGATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080931.1-2374s21c1
Sequence:GTACCGGGAATTAACACCTGGATCTAAACTCGAGTTTAGATCCAGGTGTTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080931.1-1022s21c1
Sequence:CCGGCCGCACAGAAGTGGGTCAAATCTCGAGATTTGACCCACTTCTGTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)