EMAIL THIS PAGE TO A FRIEND

MED13L

mediator complex subunit 13-like

216 Gene Product Result for
Synonyms: PROSIT240 THRAP2 TRAP240L
Gene ID:
Human(23389) Summary: The protein encoded by this gene is a subunit of the Mediator complex, a large complex of proteins that functions as a transcriptional coactivator for most RNA polymerase II-transcribed genes. The encoded protein is involved in early development of the heart and brain. Defects in this gene are a cause of transposition of the great arteries, dextro-looped (DTGA).[provided by RefSeq, Jul 2010]
Mouse(76199) mediator complex subunit 13-like
Rat(360817) mediator complex subunit 13-like
chicken(417027) mediator complex subunit 13-like
dog(477496) mediator complex subunit 13-like
Horse(100055637) mediator complex subunit 13-like
cow(517336) mediator complex subunit 13-like
domestic cat(101099593) mediator complex subunit 13-like
domestic guinea pig(100728565) mediator complex subunit 13-like
naked mole-rat(101717052) mediator complex subunit 13-like
sheep(101108604) mediator complex subunit 13-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_034056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_034056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_034056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015335 Rosetta Predictions human pricing
NM_001108337 Rosetta Predictions rat pricing
NM_172424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151258 predicted 4697
2 SASI_Hs02_00347637 predicted 4883
3 SASI_Hs02_00347638 predicted 3957
4 SASI_Hs01_00151259 predicted 4306
5 SASI_Hs01_00151260 predicted 2465
6 SASI_Hs01_00151262 predicted 1325
7 SASI_Hs01_00151264 predicted 1160
8 SASI_Hs01_00151265 predicted 6396
9 SASI_Hs01_00151266 predicted 1514
10 SASI_Hs01_00151267 predicted 5686
11 SASI_Hs01_00151261 predicted 6271
12 SASI_Hs01_00151263 predicted 5383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237669 predicted 5179
2 SASI_Rn02_00237670 predicted 4997
3 SASI_Rn02_00237671 predicted 6336
4 SASI_Rn02_00237672 predicted 2835
5 SASI_Rn02_00237673 predicted 5139
6 SASI_Rn02_00237674 predicted 5746
7 SASI_Rn02_00237675 predicted 5017
8 SASI_Rn02_00237676 predicted 3401
9 SASI_Rn02_00237677 predicted 4354
10 SASI_Rn02_00237678 predicted 6541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064229 predicted 5204
2 SASI_Mm01_00064230 predicted 764
3 SASI_Mm01_00064231 predicted 227
4 SASI_Mm01_00064232 predicted 1789
5 SASI_Mm01_00064233 predicted 341
6 SASI_Mm01_00064234 predicted 5542
7 SASI_Mm01_00064235 predicted 2308
8 SASI_Mm01_00064236 predicted 3787
9 SASI_Mm01_00064237 predicted 5228
10 SASI_Mm01_00064238 predicted 627
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015335
VALIDATED
MED13L MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 13-like
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000233503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-779s21c1
Sequence:CCGGTGATCAATGAGGAGCATATACCTCGAGGTATATGCTCCTCATTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015335.2-4450s21c1
Sequence:CCGGCACCGTGATGTTGCCTATATTCTCGAGAATATAGGCAACATCACGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-7781s21c1
Sequence:CCGGATATAGTCACAACGGAAATATCTCGAGATATTTCCGTTGTGACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-4729s21c1
Sequence:CCGGCATCACCTAGCACCTTATTTACTCGAGTAAATAAGGTGCTAGGTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015335
VALIDATED
MED13L MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 13-like
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000233503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-779s21c1
Sequence:CCGGTGATCAATGAGGAGCATATACCTCGAGGTATATGCTCCTCATTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015335.2-4450s21c1
Sequence:CCGGCACCGTGATGTTGCCTATATTCTCGAGAATATAGGCAACATCACGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-7781s21c1
Sequence:CCGGATATAGTCACAACGGAAATATCTCGAGATATTTCCGTTGTGACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-4729s21c1
Sequence:CCGGCATCACCTAGCACCTTATTTACTCGAGTAAATAAGGTGCTAGGTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015335
VALIDATED
MED13L MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 13-like
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000233503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-779s21c1
Sequence:CCGGTGATCAATGAGGAGCATATACCTCGAGGTATATGCTCCTCATTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015335.2-4450s21c1
Sequence:CCGGCACCGTGATGTTGCCTATATTCTCGAGAATATAGGCAACATCACGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-7781s21c1
Sequence:CCGGATATAGTCACAACGGAAATATCTCGAGATATTTCCGTTGTGACTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015335.2-4729s21c1
Sequence:CCGGCATCACCTAGCACCTTATTTACTCGAGTAAATAAGGTGCTAGGTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_034056
VALIDATED
MED13L MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 13-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-7857s1c1
Sequence:CCGGCCTGTTTCTAACCCTTGTGTTCTCGAGAACACAAGGGTTAGAAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-2740s1c1
Sequence:CCGGCCCGAGGAAATTAAGGACTTTCTCGAGAAAGTCCTTAATTTCCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-4529s1c1
Sequence:CCGGGCCTATTGATACCACCTAAATCTCGAGATTTAGGTGGTATCAATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-238s1c1
Sequence:CCGGCCCAACCTAGTGGGTGTAATACTCGAGTATTACACCCACTAGGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-3460s1c1
Sequence:CCGGGCGATTATGAACCGCAAACTTCTCGAGAAGTTTGCGGTTCATAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_034056
VALIDATED
MED13L MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 13-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-7857s1c1
Sequence:CCGGCCTGTTTCTAACCCTTGTGTTCTCGAGAACACAAGGGTTAGAAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-2740s1c1
Sequence:CCGGCCCGAGGAAATTAAGGACTTTCTCGAGAAAGTCCTTAATTTCCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-4529s1c1
Sequence:CCGGGCCTATTGATACCACCTAAATCTCGAGATTTAGGTGGTATCAATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-238s1c1
Sequence:CCGGCCCAACCTAGTGGGTGTAATACTCGAGTATTACACCCACTAGGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-3460s1c1
Sequence:CCGGGCGATTATGAACCGCAAACTTCTCGAGAAGTTTGCGGTTCATAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_034056
VALIDATED
MED13L MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 13-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-7857s1c1
Sequence:CCGGCCTGTTTCTAACCCTTGTGTTCTCGAGAACACAAGGGTTAGAAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-2740s1c1
Sequence:CCGGCCCGAGGAAATTAAGGACTTTCTCGAGAAAGTCCTTAATTTCCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-4529s1c1
Sequence:CCGGGCCTATTGATACCACCTAAATCTCGAGATTTAGGTGGTATCAATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_034056.7-238s1c1
Sequence:CCGGCCCAACCTAGTGGGTGTAATACTCGAGTATTACACCCACTAGGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:XM_034056.7-3460s1c1
Sequence:CCGGGCGATTATGAACCGCAAACTTCTCGAGAAGTTTGCGGTTCATAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172424
VALIDATED
MED13L MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 13-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-6658s1c1
Sequence:CCGGCATGCTCTAACCGGGAAGGGACTCGAGTCCCTTCCCGGTTAGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172424.2-6093s1c1
Sequence:CCGGCCCAACAATGATGACATGTTTCTCGAGAAACATGTCATCATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-407s1c1
Sequence:CCGGGCTCTTCAAAGCAATCCACAACTCGAGTTGTGGATTGCTTTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-5403s1c1
Sequence:CCGGCCCAGTCCAATCCAGCTTTATCTCGAGATAAAGCTGGATTGGACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-4282s1c1
Sequence:CCGGGCCACCGTGATGTTGCTTATACTCGAGTATAAGCAACATCACGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172424
VALIDATED
MED13L MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 13-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-6658s1c1
Sequence:CCGGCATGCTCTAACCGGGAAGGGACTCGAGTCCCTTCCCGGTTAGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172424.2-6093s1c1
Sequence:CCGGCCCAACAATGATGACATGTTTCTCGAGAAACATGTCATCATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-407s1c1
Sequence:CCGGGCTCTTCAAAGCAATCCACAACTCGAGTTGTGGATTGCTTTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-5403s1c1
Sequence:CCGGCCCAGTCCAATCCAGCTTTATCTCGAGATAAAGCTGGATTGGACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-4282s1c1
Sequence:CCGGGCCACCGTGATGTTGCTTATACTCGAGTATAAGCAACATCACGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172424
VALIDATED
MED13L MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 13-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-6658s1c1
Sequence:CCGGCATGCTCTAACCGGGAAGGGACTCGAGTCCCTTCCCGGTTAGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172424.2-6093s1c1
Sequence:CCGGCCCAACAATGATGACATGTTTCTCGAGAAACATGTCATCATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-407s1c1
Sequence:CCGGGCTCTTCAAAGCAATCCACAACTCGAGTTGTGGATTGCTTTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-5403s1c1
Sequence:CCGGCCCAGTCCAATCCAGCTTTATCTCGAGATAAAGCTGGATTGGACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172424.2-4282s1c1
Sequence:CCGGGCCACCGTGATGTTGCTTATACTCGAGTATAAGCAACATCACGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)