EMAIL THIS PAGE TO A FRIEND

MED14

mediator complex subunit 14

226 Gene Product Result for
Synonyms: CRSP150 CRSP2 CSRP CXorf4 DRIP150 EXLM1 RGR1 TRAP170
UniProtKB ID: O60244, Q4KMR7, Q9UNB3
Gene ID:
Human(9282) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein contains a bipartite nuclear localization signal. This gene is known to escape chromosome X-inactivation. [provided by RefSeq, Jul 2008]
Mouse(26896) mediator complex subunit 14
Rat(317343) mediator complex subunit 14
Zebrafish(336923) mediator complex subunit 14
cow(529109) mediator complex subunit 14
Horse(100050409) mediator complex subunit 14
domestic cat(101085274) mediator complex subunit 14
dog(480884) mediator complex subunit 14
chicken(418572) mediator complex subunit 14
fruit fly(38073) Mediator complex subunit 14
sheep(101123354) mediator complex subunit 14
naked mole-rat(101701968) mediator complex subunit 14
domestic guinea pig(100731834) mediator complex subunit 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_358387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_358387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_358387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004229 Rosetta Predictions human pricing
XM_001056908 Rosetta Predictions rat pricing
XM_228713 Rosetta Predictions rat pricing
NM_001048208 Rosetta Predictions mouse pricing
NM_012005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128518 predicted 2364
2 SASI_Hs01_00128519 predicted 1376
3 SASI_Hs01_00128520 predicted 3533
4 SASI_Hs01_00128522 predicted 2440
5 SASI_Hs02_00337146 predicted 450
6 SASI_Hs01_00128523 predicted 1335
7 SASI_Hs01_00128524 predicted 1301
8 SASI_Hs01_00128526 predicted 1715
9 SASI_Hs02_00337147 predicted 2201
10 SASI_Hs01_00128527 predicted 2975
11 SASI_Hs01_00128521 predicted 4001
12 SASI_Hs01_00128525 predicted 4060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284833 predicted 578
2 SASI_Rn02_00284834 predicted 2734
3 SASI_Rn02_00284835 predicted 3368
4 SASI_Rn02_00284836 predicted 2604
5 SASI_Rn02_00284837 predicted 1883
6 SASI_Rn02_00284838 predicted 2278
7 SASI_Rn02_00284839 predicted 1188
8 SASI_Rn02_00284840 predicted 757
9 SASI_Rn02_00284841 predicted 847
10 SASI_Rn02_00284842 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385410 predicted 584
2 SASI_Rn02_00385411 predicted 2732
3 SASI_Rn02_00385412 predicted 3367
4 SASI_Rn02_00385413 predicted 2602
5 SASI_Rn02_00385414 predicted 1892
6 SASI_Rn02_00385415 predicted 2279
7 SASI_Rn02_00385416 predicted 1188
8 SASI_Rn02_00385417 predicted 750
9 SASI_Rn02_00385418 predicted 855
10 SASI_Rn02_00385419 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048208 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292219 predicted 1188
2 SASI_Mm02_00292220 predicted 1493
3 SASI_Mm02_00292221 predicted 574
4 SASI_Mm02_00292222 predicted 3362
5 SASI_Mm02_00292223 predicted 860
6 SASI_Mm02_00292224 predicted 1542
7 SASI_Mm02_00292225 predicted 850
8 SASI_Mm02_00292226 predicted 880
9 SASI_Mm02_00292227 predicted 560
10 SASI_Mm02_00292228 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148555 predicted 1183
2 SASI_Mm01_00148556 predicted 1490
3 SASI_Mm01_00148557 predicted 579
4 SASI_Mm02_00321943 predicted 3368
5 SASI_Mm01_00148559 predicted 852
6 SASI_Mm01_00148560 predicted 1540
7 SASI_Mm01_00148563 predicted 846
8 SASI_Mm01_00148564 predicted 881
9 SASI_Mm02_00321944 predicted 560
10 SASI_Mm02_00321945 predicted 439
11 SASI_Mm01_00148558 predicted 1638
12 SASI_Mm01_00148561 predicted 2520
13 SASI_Mm01_00148562 predicted 1669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004229
VALIDATED
MED14 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-780s1c1
Sequence:CCGGCGGGTGAAGTTTCGTGTTGAACTCGAGTTCAACACGAAACTTCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-4437s1c1
Sequence:CCGGCGTGATTTAATGGCTAATCTTCTCGAGAAGATTAGCCATTAAATCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-1666s1c1
Sequence:CCGGGCAGTGAAACATTGCAGCTTTCTCGAGAAAGCTGCAATGTTTCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-396s1c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-2155s1c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004229.3-4740s21c1
Sequence:CCGGGTGTCCGTTTGCCAGTAATAACTCGAGTTATTACTGGCAAACGGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-417s21c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2176s21c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2073s21c1
Sequence:CCGGGTCGCTATGTGTGATACAAATCTCGAGATTTGTATCACACATAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-1831s21c1
Sequence:CCGGTGTCGTACAAGTACTACTTTACTCGAGTAAAGTAGTACTTGTACGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004229
VALIDATED
MED14 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-780s1c1
Sequence:CCGGCGGGTGAAGTTTCGTGTTGAACTCGAGTTCAACACGAAACTTCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-4437s1c1
Sequence:CCGGCGTGATTTAATGGCTAATCTTCTCGAGAAGATTAGCCATTAAATCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-1666s1c1
Sequence:CCGGGCAGTGAAACATTGCAGCTTTCTCGAGAAAGCTGCAATGTTTCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-396s1c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-2155s1c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004229.3-4740s21c1
Sequence:CCGGGTGTCCGTTTGCCAGTAATAACTCGAGTTATTACTGGCAAACGGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-417s21c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2176s21c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2073s21c1
Sequence:CCGGGTCGCTATGTGTGATACAAATCTCGAGATTTGTATCACACATAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-1831s21c1
Sequence:CCGGTGTCGTACAAGTACTACTTTACTCGAGTAAAGTAGTACTTGTACGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004229
VALIDATED
MED14 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-780s1c1
Sequence:CCGGCGGGTGAAGTTTCGTGTTGAACTCGAGTTCAACACGAAACTTCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-4437s1c1
Sequence:CCGGCGTGATTTAATGGCTAATCTTCTCGAGAAGATTAGCCATTAAATCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-1666s1c1
Sequence:CCGGGCAGTGAAACATTGCAGCTTTCTCGAGAAAGCTGCAATGTTTCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-396s1c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004229.2-2155s1c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004229.3-4740s21c1
Sequence:CCGGGTGTCCGTTTGCCAGTAATAACTCGAGTTATTACTGGCAAACGGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-417s21c1
Sequence:CCGGCGCCAACTCTTCGTTCGATTACTCGAGTAATCGAACGAAGAGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2176s21c1
Sequence:CCGGGCCATGCAATTCGCTTATTAACTCGAGTTAATAAGCGAATTGCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-2073s21c1
Sequence:CCGGGTCGCTATGTGTGATACAAATCTCGAGATTTGTATCACACATAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004229.3-1831s21c1
Sequence:CCGGTGTCGTACAAGTACTACTTTACTCGAGTAAAGTAGTACTTGTACGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_358387
VALIDATED
MED14 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-1180s1c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-225s1c1
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-902s1c1
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358387.1-900s1c1
Sequence:CCGGCTGCCTACATTGTTTCTGCTTCTCGAGAAGCAGAAACAATGTAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-298s1c1
Sequence:CCGGCAACTCTTCGTTCGATTATTACTCGAGTAATAATCGAACGAAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_358387
VALIDATED
MED14 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-1180s1c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-225s1c1
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-902s1c1
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358387.1-900s1c1
Sequence:CCGGCTGCCTACATTGTTTCTGCTTCTCGAGAAGCAGAAACAATGTAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-298s1c1
Sequence:CCGGCAACTCTTCGTTCGATTATTACTCGAGTAATAATCGAACGAAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_358387
VALIDATED
MED14 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-1180s1c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-225s1c1
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-902s1c1
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_358387.1-900s1c1
Sequence:CCGGCTGCCTACATTGTTTCTGCTTCTCGAGAAGCAGAAACAATGTAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_358387.1-298s1c1
Sequence:CCGGCAACTCTTCGTTCGATTATTACTCGAGTAATAATCGAACGAAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012005
MED14 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1972s21c1
Sequence:CCGGGCCTACGCAGCTATCATATAACTCGAGTTATATGATAGCTGCGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1176s21c3
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012005.3-4712s21c1
Sequence:CCGGTGCCATGGCCCTCTTAGTTAGCTCGAGCTAACTAAGAGGGCCATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1457s21c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-499s21c2
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012005
MED14 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1972s21c1
Sequence:CCGGGCCTACGCAGCTATCATATAACTCGAGTTATATGATAGCTGCGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1176s21c3
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012005.3-4712s21c1
Sequence:CCGGTGCCATGGCCCTCTTAGTTAGCTCGAGCTAACTAAGAGGGCCATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1457s21c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-499s21c2
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012005
MED14 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1972s21c1
Sequence:CCGGGCCTACGCAGCTATCATATAACTCGAGTTATATGATAGCTGCGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1176s21c3
Sequence:CCGGGCCTACATTGTTTCTGCTTATCTCGAGATAAGCAGAAACAATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012005.3-4712s21c1
Sequence:CCGGTGCCATGGCCCTCTTAGTTAGCTCGAGCTAACTAAGAGGGCCATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-1457s21c1
Sequence:CCGGGCCATGAAGATTGACCACTTACTCGAGTAAGTGGTCAATCTTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012005.3-499s21c2
Sequence:CCGGGACGGACTTATTGCCAAGGAACTCGAGTTCCTTGGCAATAAGTCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)