EMAIL THIS PAGE TO A FRIEND

MED15

mediator complex subunit 15

71 Gene Product Result for
Synonyms: ARC105 CAG7A CTG7A PCQAP TIG-1 TIG1 TNRC7
Gene ID:
Human(51586) Summary: The protein encoded by this gene is a subunit of the multiprotein complexes PC2 and ARC/DRIP and may function as a transcriptional coactivator in RNA polymerase II transcription. This gene contains stretches of trinucleotide repeats and is located in the chromosome 22 region which is deleted in DiGeorge syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(94112) mediator complex subunit 15
Rat(360743) mediator complex subunit 15
Zebrafish(406346) mediator complex subunit 15
fruit fly(33223) Mediator complex subunit 15
cow(618232) mediator complex subunit 15
domestic cat(101099909) mediator complex subunit 15
dog(608008) mediator complex subunit 15
chicken(416941) mediator complex subunit 15
domestic guinea pig(100733835) mediator complex subunit 15
naked mole-rat(101697759) mediator complex subunit 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003891 Rosetta Predictions human pricing
NM_015889 Rosetta Predictions human pricing
NM_001108325 Rosetta Predictions rat pricing
NM_001040683 Rosetta Predictions mouse pricing
NM_033609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169124 predicted 2602
2 SASI_Hs01_00169125 predicted 2582
3 SASI_Hs01_00169126 predicted 221
4 SASI_Hs02_00304414 predicted 219
5 SASI_Hs02_00304415 predicted 2014
6 SASI_Hs01_00169127 predicted 2241
7 SASI_Hs01_00169128 predicted 1962
8 SASI_Hs01_00169129 predicted 2770
9 SASI_Hs02_00304416 predicted 2265
10 SASI_Hs01_00169131 predicted 302
11 SASI_Hs01_00169123 predicted 2516
12 SASI_Hs01_00169130 predicted 2173
13 SASI_Hs01_00169132 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153725 predicted 2477
2 SASI_Hs01_00153726 predicted 2459
3 SASI_Hs01_00153727 predicted 225
4 SASI_Hs02_00348474 predicted 216
5 SASI_Hs02_00348475 predicted 1901
6 SASI_Hs01_00153728 predicted 2120
7 SASI_Hs01_00153729 predicted 1842
8 SASI_Hs01_00153730 predicted 2653
9 SASI_Hs02_00348476 predicted 2145
10 SASI_Hs01_00153732 predicted 304
11 SASI_Hs01_00153724 predicted 2389
12 SASI_Hs01_00153731 predicted 2047
13 SASI_Hs01_00153733 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237549 predicted 2026
2 SASI_Rn02_00237550 predicted 2065
3 SASI_Rn02_00237551 predicted 2847
4 SASI_Rn02_00237552 predicted 2751
5 SASI_Rn02_00237553 predicted 1662
6 SASI_Rn02_00237554 predicted 1881
7 SASI_Rn02_00237555 predicted 2859
8 SASI_Rn02_00237556 predicted 1825
9 SASI_Rn02_00237557 predicted 2733
10 SASI_Rn02_00237558 predicted 2365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168191 predicted 2333
2 SASI_Mm01_00168192 predicted 276
3 SASI_Mm01_00168193 predicted 245
4 SASI_Mm01_00168194 predicted 2071
5 SASI_Mm01_00168196 predicted 298
6 SASI_Mm01_00168197 predicted 2347
7 SASI_Mm01_00168198 predicted 2187
8 SASI_Mm01_00168199 predicted 218
9 SASI_Mm01_00168200 predicted 2846
10 SASI_Mm02_00290335 predicted 2054
11 SASI_Mm01_00168195 predicted 2033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084355 predicted 2459
2 SASI_Mm01_00084356 predicted 275
3 SASI_Mm01_00084357 predicted 244
4 SASI_Mm01_00084358 predicted 2191
5 SASI_Mm01_00084360 predicted 300
6 SASI_Mm01_00084361 predicted 2473
7 SASI_Mm01_00084362 predicted 2302
8 SASI_Mm01_00084363 predicted 219
9 SASI_Mm01_00084364 predicted 2968
10 SASI_Mm02_00337468 predicted 2177
11 SASI_Mm01_00084359 predicted 2157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033609
VALIDATED
MED15 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 15
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1715s21c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033609.2-2711s21c1
Sequence:CCGGGTTTGGTTTGTTTCGTTATTTCTCGAGAAATAACGAAACAAACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1754s21c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-2320s21c1
Sequence:CCGGTCGACCGTCAGTGGCAATATGCTCGAGCATATTGCCACTGACGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-293s21c1
Sequence:CCGGCATTATCCATTTCCGAGATATCTCGAGATATCTCGGAAATGGATAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033609.1-3049s1c1
Sequence:CCGGGCTATGATACACAGGCAGATACTCGAGTATCTGCCTGTGTATCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1608s1c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1647s1c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033609.1-667s1c1
Sequence:CCGGCACCTGATTAAGTTGCATCATCTCGAGATGATGCAACTTAATCAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-2716s1c1
Sequence:CCGGGCCCATCAAAGCATCTCTGTTCTCGAGAACAGAGATGCTTTGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033609.1-2717s1c1
Sequence:CCGGCCCATCAAAGCATCTCTGTTTCTCGAGAAACAGAGATGCTTTGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033609.1-181s1c1
Sequence:CCGGCGACTCATTATCCATTTCCGACTCGAGTCGGAAATGGATAATGAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033609
VALIDATED
MED15 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 15
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1715s21c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033609.2-2711s21c1
Sequence:CCGGGTTTGGTTTGTTTCGTTATTTCTCGAGAAATAACGAAACAAACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1754s21c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-2320s21c1
Sequence:CCGGTCGACCGTCAGTGGCAATATGCTCGAGCATATTGCCACTGACGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-293s21c1
Sequence:CCGGCATTATCCATTTCCGAGATATCTCGAGATATCTCGGAAATGGATAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033609.1-3049s1c1
Sequence:CCGGGCTATGATACACAGGCAGATACTCGAGTATCTGCCTGTGTATCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1608s1c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1647s1c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033609.1-667s1c1
Sequence:CCGGCACCTGATTAAGTTGCATCATCTCGAGATGATGCAACTTAATCAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-2716s1c1
Sequence:CCGGGCCCATCAAAGCATCTCTGTTCTCGAGAACAGAGATGCTTTGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033609.1-2717s1c1
Sequence:CCGGCCCATCAAAGCATCTCTGTTTCTCGAGAAACAGAGATGCTTTGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033609.1-181s1c1
Sequence:CCGGCGACTCATTATCCATTTCCGACTCGAGTCGGAAATGGATAATGAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033609
VALIDATED
MED15 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 15
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1715s21c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033609.2-2711s21c1
Sequence:CCGGGTTTGGTTTGTTTCGTTATTTCTCGAGAAATAACGAAACAAACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-1754s21c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-2320s21c1
Sequence:CCGGTCGACCGTCAGTGGCAATATGCTCGAGCATATTGCCACTGACGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033609.2-293s21c1
Sequence:CCGGCATTATCCATTTCCGAGATATCTCGAGATATCTCGGAAATGGATAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_033609.1-3049s1c1
Sequence:CCGGGCTATGATACACAGGCAGATACTCGAGTATCTGCCTGTGTATCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1608s1c1
Sequence:CCGGGCTGAAGCAATTGTCCAAGTACTCGAGTACTTGGACAATTGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-1647s1c1
Sequence:CCGGCATGATCAACAAGATCGACAACTCGAGTTGTCGATCTTGTTGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033609.1-667s1c1
Sequence:CCGGCACCTGATTAAGTTGCATCATCTCGAGATGATGCAACTTAATCAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173866    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033609.1-2716s1c1
Sequence:CCGGGCCCATCAAAGCATCTCTGTTCTCGAGAACAGAGATGCTTTGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175346    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033609.1-2717s1c1
Sequence:CCGGCCCATCAAAGCATCTCTGTTTCTCGAGAAACAGAGATGCTTTGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033609.1-181s1c1
Sequence:CCGGCGACTCATTATCCATTTCCGACTCGAGTCGGAAATGGATAATGAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015889
VALIDATED
MED15 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-309s21c1
Sequence:CCGGTCCGTCAGTGATCCTATGAATCTCGAGATTCATAGGATCACTGACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-783s21c1
Sequence:CCGGCAACAGCAGCTGCAGCGAATACTCGAGTATTCGCTGCAGCTGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015889.3-2137s21c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-251s21c1
Sequence:CCGGTCTCGTGGCCAGGCTCATTATCTCGAGATAATGAGCCTGGCCACGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-2722s21c1
Sequence:CCGGGAGGACATAGGAAACCCTTAACTCGAGTTAAGGGTTTCCTATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1761s1c1
Sequence:CCGGCGACCAAACAGCAGTACCTATCTCGAGATAGGTACTGCTGTTTGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1588s1c1
Sequence:CCGGCGACAAGAACGAAGACAGAAACTCGAGTTTCTGTCTTCGTTCTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015889.2-980s1c1
Sequence:CCGGGCTCAGAACCAACCATCACAACTCGAGTTGTGATGGTTGGTTCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-2106s1c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015889
VALIDATED
MED15 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-309s21c1
Sequence:CCGGTCCGTCAGTGATCCTATGAATCTCGAGATTCATAGGATCACTGACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-783s21c1
Sequence:CCGGCAACAGCAGCTGCAGCGAATACTCGAGTATTCGCTGCAGCTGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015889.3-2137s21c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-251s21c1
Sequence:CCGGTCTCGTGGCCAGGCTCATTATCTCGAGATAATGAGCCTGGCCACGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-2722s21c1
Sequence:CCGGGAGGACATAGGAAACCCTTAACTCGAGTTAAGGGTTTCCTATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1761s1c1
Sequence:CCGGCGACCAAACAGCAGTACCTATCTCGAGATAGGTACTGCTGTTTGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1588s1c1
Sequence:CCGGCGACAAGAACGAAGACAGAAACTCGAGTTTCTGTCTTCGTTCTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015889.2-980s1c1
Sequence:CCGGGCTCAGAACCAACCATCACAACTCGAGTTGTGATGGTTGGTTCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-2106s1c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015889
VALIDATED
MED15 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-309s21c1
Sequence:CCGGTCCGTCAGTGATCCTATGAATCTCGAGATTCATAGGATCACTGACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-783s21c1
Sequence:CCGGCAACAGCAGCTGCAGCGAATACTCGAGTATTCGCTGCAGCTGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015889.3-2137s21c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-251s21c1
Sequence:CCGGTCTCGTGGCCAGGCTCATTATCTCGAGATAATGAGCCTGGCCACGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015889.3-2722s21c1
Sequence:CCGGGAGGACATAGGAAACCCTTAACTCGAGTTAAGGGTTTCCTATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1761s1c1
Sequence:CCGGCGACCAAACAGCAGTACCTATCTCGAGATAGGTACTGCTGTTTGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-1588s1c1
Sequence:CCGGCGACAAGAACGAAGACAGAAACTCGAGTTTCTGTCTTCGTTCTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015889.2-980s1c1
Sequence:CCGGGCTCAGAACCAACCATCACAACTCGAGTTGTGATGGTTGGTTCTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015889.2-2106s1c1
Sequence:CCGGCCGCTGACTATCCTGCCCAAACTCGAGTTTGGGCAGGATAGTCAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)