EMAIL THIS PAGE TO A FRIEND

MED16

mediator complex subunit 16

54 Gene Product Result for
Synonyms: DRIP92 THRAP5 TRAP95
UniProtKB ID: Q9Y2X0, Q6PJT2, Q96AD4, Q96I35, Q9Y652
Gene ID:
Mouse(216154) mediator complex subunit 16
Rat(299607) mediator complex subunit 16
Zebrafish(570199) mediator complex subunit 16
cow(100298629) mediator complex subunit 16
domestic cat(101093753) mediator complex subunit 16
dog(485094) mediator complex subunit 16
fruit fly(37535) Mediator complex subunit 16
chicken(420099) mediator complex subunit 16
sheep(101111097) mediator complex subunit 16
naked mole-rat(101714369) mediator complex subunit 16
domestic guinea pig(100724969) mediator complex subunit 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005481 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198107 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198107 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198107 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005481 Rosetta Predictions human pricing
NM_001106768 Rosetta Predictions rat pricing
NM_198107 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220487 predicted 1181
2 SASI_Hs01_00220489 predicted 1957
3 SASI_Hs01_00220490 predicted 2553
4 SASI_Hs01_00220491 predicted 1937
5 SASI_Hs01_00220492 predicted 1614
6 SASI_Hs01_00220494 predicted 745
7 SASI_Hs01_00220495 predicted 1443
8 SASI_Hs01_00220496 predicted 2014
9 SASI_Hs02_00339668 predicted 629
10 SASI_Hs02_00339669 predicted 1442
11 SASI_Hs01_00220488 predicted 402
12 SASI_Hs01_00220493 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222208 predicted 283
2 SASI_Rn02_00222209 predicted 1902
3 SASI_Rn02_00222210 predicted 607
4 SASI_Rn02_00222211 predicted 405
5 SASI_Rn02_00222212 predicted 1899
6 SASI_Rn02_00222213 predicted 2184
7 SASI_Rn02_00222214 predicted 2065
8 SASI_Rn02_00222215 predicted 1169
9 SASI_Rn02_00222216 predicted 2118
10 SASI_Rn02_00222217 predicted 2647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198107 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160148 predicted 1869
2 SASI_Mm01_00160149 predicted 2182
3 SASI_Mm02_00350835 predicted 1861
4 SASI_Mm01_00160150 predicted 1825
5 SASI_Mm01_00160151 predicted 222
6 SASI_Mm01_00160152 predicted 1195
7 SASI_Mm02_00350836 predicted 1924
8 SASI_Mm01_00160155 predicted 2034
9 SASI_Mm01_00160156 predicted 1822
10 SASI_Mm01_00160157 predicted 984
11 SASI_Mm01_00160153 predicted 1137
12 SASI_Mm01_00160154 predicted 1153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005481
VALIDATED
MED16 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1921s1c1
Sequence:CCGGCGACATTGACAAGGTCATGATCTCGAGATCATGACCTTGTCAATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-2554s1c1
Sequence:CCGGCGGCTGTGTCACCATGCTCAACTCGAGTTGAGCATGGTGACACAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-962s1c1
Sequence:CCGGCTCAACCGCAAGGACAAGTTTCTCGAGAAACTTGTCCTTGCGGTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1435s1c1
Sequence:CCGGCGTCCACTTAAAGGCTATGCACTCGAGTGCATAGCCTTTAAGTGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1852s1c1
Sequence:CCGGCTTTCTCAACACGCCTGACAACTCGAGTTGTCAGGCGTGTTGAGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-273s21c1
Sequence:CCGGGCCGAAATCTCATCGCCTTCACTCGAGTGAAGGCGATGAGATTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-185s21c1
Sequence:CCGGATGATGGACTTGGCCTACGTCCTCGAGGACGTAGGCCAAGTCCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-2106s21c1
Sequence:CCGGTGGGCATGCTTCGGGAATTGACTCGAGTCAATTCCCGAAGCATGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-209s21c1
Sequence:CCGGGAGTGGGAGAAATGGTCCAAGCTCGAGCTTGGACCATTTCTCCCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-1944s21c1
Sequence:CCGGACCTCAAGACGGAGGAATTTGCTCGAGCAAATTCCTCCGTCTTGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005481
VALIDATED
MED16 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1921s1c1
Sequence:CCGGCGACATTGACAAGGTCATGATCTCGAGATCATGACCTTGTCAATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-2554s1c1
Sequence:CCGGCGGCTGTGTCACCATGCTCAACTCGAGTTGAGCATGGTGACACAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-962s1c1
Sequence:CCGGCTCAACCGCAAGGACAAGTTTCTCGAGAAACTTGTCCTTGCGGTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1435s1c1
Sequence:CCGGCGTCCACTTAAAGGCTATGCACTCGAGTGCATAGCCTTTAAGTGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1852s1c1
Sequence:CCGGCTTTCTCAACACGCCTGACAACTCGAGTTGTCAGGCGTGTTGAGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-273s21c1
Sequence:CCGGGCCGAAATCTCATCGCCTTCACTCGAGTGAAGGCGATGAGATTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-185s21c1
Sequence:CCGGATGATGGACTTGGCCTACGTCCTCGAGGACGTAGGCCAAGTCCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-2106s21c1
Sequence:CCGGTGGGCATGCTTCGGGAATTGACTCGAGTCAATTCCCGAAGCATGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-209s21c1
Sequence:CCGGGAGTGGGAGAAATGGTCCAAGCTCGAGCTTGGACCATTTCTCCCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-1944s21c1
Sequence:CCGGACCTCAAGACGGAGGAATTTGCTCGAGCAAATTCCTCCGTCTTGAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005481
VALIDATED
MED16 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1921s1c1
Sequence:CCGGCGACATTGACAAGGTCATGATCTCGAGATCATGACCTTGTCAATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-2554s1c1
Sequence:CCGGCGGCTGTGTCACCATGCTCAACTCGAGTTGAGCATGGTGACACAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-962s1c1
Sequence:CCGGCTCAACCGCAAGGACAAGTTTCTCGAGAAACTTGTCCTTGCGGTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1435s1c1
Sequence:CCGGCGTCCACTTAAAGGCTATGCACTCGAGTGCATAGCCTTTAAGTGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005481.2-1852s1c1
Sequence:CCGGCTTTCTCAACACGCCTGACAACTCGAGTTGTCAGGCGTGTTGAGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-273s21c1
Sequence:CCGGGCCGAAATCTCATCGCCTTCACTCGAGTGAAGGCGATGAGATTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-185s21c1
Sequence:CCGGATGATGGACTTGGCCTACGTCCTCGAGGACGTAGGCCAAGTCCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-2106s21c1
Sequence:CCGGTGGGCATGCTTCGGGAATTGACTCGAGTCAATTCCCGAAGCATGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-209s21c1
Sequence:CCGGGAGTGGGAGAAATGGTCCAAGCTCGAGCTTGGACCATTTCTCCCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005481.2-1944s21c1
Sequence:CCGGACCTCAAGACGGAGGAATTTGCTCGAGCAAATTCCTCCGTCTTGAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198107
VALIDATED
MED16 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 16
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-2727s21c1
Sequence:CCGGCTGAAGTCCCATGGTCATATCCTCGAGGATATGACCATGGGACTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198107.1-1026s1c1
Sequence:CCGGGAACAATATCTTCCAGCAGATCTCGAGATCTGCTGGAAGATATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198107.1-2627s1c2
Sequence:CCGGCAGTCTCTGAACATTGACATTCTCGAGAATGTCAATGTTCAGAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-243s21c1
Sequence:CCGGTCTGACACACATGATCCATATCTCGAGATATGGATCATGTGTGTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-372s21c1
Sequence:CCGGTGCTGATGGACAGATCAAATGCTCGAGCATTTGATCTGTCCATCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-477s21c1
Sequence:CCGGCTGGCTGCACAACGGTGTAAACTCGAGTTTACACCGTTGTGCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-1343s21c1
Sequence:CCGGCATGCCCTGCCGTACACTTTACTCGAGTAAAGTGTACGGCAGGGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198107
VALIDATED
MED16 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 16
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-2727s21c1
Sequence:CCGGCTGAAGTCCCATGGTCATATCCTCGAGGATATGACCATGGGACTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198107.1-1026s1c1
Sequence:CCGGGAACAATATCTTCCAGCAGATCTCGAGATCTGCTGGAAGATATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198107.1-2627s1c2
Sequence:CCGGCAGTCTCTGAACATTGACATTCTCGAGAATGTCAATGTTCAGAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-243s21c1
Sequence:CCGGTCTGACACACATGATCCATATCTCGAGATATGGATCATGTGTGTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-372s21c1
Sequence:CCGGTGCTGATGGACAGATCAAATGCTCGAGCATTTGATCTGTCCATCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-477s21c1
Sequence:CCGGCTGGCTGCACAACGGTGTAAACTCGAGTTTACACCGTTGTGCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-1343s21c1
Sequence:CCGGCATGCCCTGCCGTACACTTTACTCGAGTAAAGTGTACGGCAGGGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198107
VALIDATED
MED16 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 16
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-2727s21c1
Sequence:CCGGCTGAAGTCCCATGGTCATATCCTCGAGGATATGACCATGGGACTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198107.1-1026s1c1
Sequence:CCGGGAACAATATCTTCCAGCAGATCTCGAGATCTGCTGGAAGATATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198107.1-2627s1c2
Sequence:CCGGCAGTCTCTGAACATTGACATTCTCGAGAATGTCAATGTTCAGAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-243s21c1
Sequence:CCGGTCTGACACACATGATCCATATCTCGAGATATGGATCATGTGTGTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-372s21c1
Sequence:CCGGTGCTGATGGACAGATCAAATGCTCGAGCATTTGATCTGTCCATCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_198107.1-477s21c1
Sequence:CCGGCTGGCTGCACAACGGTGTAAACTCGAGTTTACACCGTTGTGCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198107.1-1343s21c1
Sequence:CCGGCATGCCCTGCCGTACACTTTACTCGAGTAAAGTGTACGGCAGGGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)