EMAIL THIS PAGE TO A FRIEND

MED17

mediator complex subunit 17

91 Gene Product Result for
Synonyms: CRSP6 CRSP77 DRIP80 TRAP80
UniProtKB ID: Q9NVC6, B3KN07, Q9HA81, Q9UNP7, Q9Y2W0, Q9Y660
Gene ID:
Human(9440) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Mouse(234959) mediator complex subunit 17
Rat(300367) mediator complex subunit 17
domestic guinea pig(100720611) mediator complex subunit 17
naked mole-rat(101706308) mediator complex subunit 17
sheep(101106726) mediator complex subunit 17
Zebrafish(567560) mediator complex subunit 17
fruit fly(42175) Mediator complex subunit 17
domestic cat(101082432) mediator complex subunit 17
cow(541303) mediator complex subunit 17
dog(476769) mediator complex subunit 17
chicken(419000) mediator complex subunit 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004268 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004268 Rosetta Predictions human pricing
NM_001106801 Rosetta Predictions rat pricing
NM_144933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337232 predicted 1658
2 SASI_Hs02_00337233 predicted 926
3 SASI_Hs02_00337234 predicted 1485
4 SASI_Hs01_00186265 predicted 1714
5 SASI_Hs01_00186266 predicted 1943
6 SASI_Hs01_00186267 predicted 1677
7 SASI_Hs01_00186268 predicted 2030
8 SASI_Hs01_00186269 predicted 1737
9 SASI_Hs01_00186271 predicted 1768
10 SASI_Hs01_00186273 predicted 1614
11 SASI_Hs01_00186270 predicted 1759
12 SASI_Hs01_00186272 predicted 579
13 SASI_Hs01_00186274 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222538 predicted 2112
2 SASI_Rn02_00222539 predicted 2099
3 SASI_Rn02_00222540 predicted 781
4 SASI_Rn02_00222541 predicted 1516
5 SASI_Rn02_00222542 predicted 1445
6 SASI_Rn02_00222543 predicted 1920
7 SASI_Rn02_00222544 predicted 1167
8 SASI_Rn02_00222545 predicted 1794
9 SASI_Rn02_00222546 predicted 669
10 SASI_Rn02_00222547 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168845 predicted 2078
2 SASI_Mm01_00168846 predicted 1831
3 SASI_Mm02_00340456 predicted 2060
4 SASI_Mm01_00168847 predicted 1388
5 SASI_Mm01_00168848 predicted 1590
6 SASI_Mm02_00340457 predicted 1741
7 SASI_Mm01_00168849 predicted 2052
8 SASI_Mm01_00168850 predicted 1449
9 SASI_Mm01_00168851 predicted 824
10 SASI_Mm01_00168852 predicted 866
11 SASI_Mm01_00168853 predicted 1334
12 SASI_Mm01_00168854 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004268
VALIDATED
MED17 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 17
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1362s21c1
Sequence:CCGGTGTCCGGAGGACCACCTTTATCTCGAGATAAAGGTGGTCCTCCGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2491s21c1
Sequence:CCGGACTAACTTAAGGGTTTCTATGCTCGAGCATAGAAACCCTTAAGTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2280s21c1
Sequence:CCGGATGTTTGCAGATCAACTATAACTCGAGTTATAGTTGATCTGCAAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1621s21c1
Sequence:CCGGACAGCTTAGCAAGCCGAATTGCTCGAGCAATTCGGCTTGCTAAGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-560s21c1
Sequence:CCGGGGACTCAGTGAGGAACAATTTCTCGAGAAATTGTTCCTCACTGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1406s21c1
Sequence:CCGGACTGATTAGAGAGTTTCATAACTCGAGTTATGAAACTCTCTAATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004268.3-1122s1c1
Sequence:CCGGCGGCACAGAATGTTCTCTTATCTCGAGATAAGAGAACATTCTGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-2029s1c1
Sequence:CCGGCCAATGTAAAGACCTTCCAAACTCGAGTTTGGAAGGTCTTTACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-578s1c1
Sequence:CCGGCTCAGTATTGTTAGGGATAAACTCGAGTTTATCCCTAACAATACTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1434s1c1
Sequence:CCGGGCCACAAGAGAATGAGACTTTCTCGAGAAAGTCTCATTCTCTTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1241s1c1
Sequence:CCGGCCGAGCTTGCAGTTATCTATTCTCGAGAATAGATAACTGCAAGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004268
VALIDATED
MED17 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 17
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1362s21c1
Sequence:CCGGTGTCCGGAGGACCACCTTTATCTCGAGATAAAGGTGGTCCTCCGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2491s21c1
Sequence:CCGGACTAACTTAAGGGTTTCTATGCTCGAGCATAGAAACCCTTAAGTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2280s21c1
Sequence:CCGGATGTTTGCAGATCAACTATAACTCGAGTTATAGTTGATCTGCAAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1621s21c1
Sequence:CCGGACAGCTTAGCAAGCCGAATTGCTCGAGCAATTCGGCTTGCTAAGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-560s21c1
Sequence:CCGGGGACTCAGTGAGGAACAATTTCTCGAGAAATTGTTCCTCACTGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1406s21c1
Sequence:CCGGACTGATTAGAGAGTTTCATAACTCGAGTTATGAAACTCTCTAATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004268.3-1122s1c1
Sequence:CCGGCGGCACAGAATGTTCTCTTATCTCGAGATAAGAGAACATTCTGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-2029s1c1
Sequence:CCGGCCAATGTAAAGACCTTCCAAACTCGAGTTTGGAAGGTCTTTACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-578s1c1
Sequence:CCGGCTCAGTATTGTTAGGGATAAACTCGAGTTTATCCCTAACAATACTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1434s1c1
Sequence:CCGGGCCACAAGAGAATGAGACTTTCTCGAGAAAGTCTCATTCTCTTGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1241s1c1
Sequence:CCGGCCGAGCTTGCAGTTATCTATTCTCGAGAATAGATAACTGCAAGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004268
VALIDATED
MED17 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 17
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1362s21c1
Sequence:CCGGTGTCCGGAGGACCACCTTTATCTCGAGATAAAGGTGGTCCTCCGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2491s21c1
Sequence:CCGGACTAACTTAAGGGTTTCTATGCTCGAGCATAGAAACCCTTAAGTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004268.4-2280s21c1
Sequence:CCGGATGTTTGCAGATCAACTATAACTCGAGTTATAGTTGATCTGCAAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1621s21c1
Sequence:CCGGACAGCTTAGCAAGCCGAATTGCTCGAGCAATTCGGCTTGCTAAGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-560s21c1
Sequence:CCGGGGACTCAGTGAGGAACAATTTCTCGAGAAATTGTTCCTCACTGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004268.4-1406s21c1
Sequence:CCGGACTGATTAGAGAGTTTCATAACTCGAGTTATGAAACTCTCTAATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004268.3-1122s1c1
Sequence:CCGGCGGCACAGAATGTTCTCTTATCTCGAGATAAGAGAACATTCTGTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-2029s1c1
Sequence:CCGGCCAATGTAAAGACCTTCCAAACTCGAGTTTGGAAGGTCTTTACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-578s1c1
Sequence:CCGGCTCAGTATTGTTAGGGATAAACTCGAGTTTATCCCTAACAATACTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1434s1c1
Sequence:CCGGGCCACAAGAGAATGAGACTTTCTCGAGAAAGTCTCATTCTCTTGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004268.3-1241s1c1
Sequence:CCGGCCGAGCTTGCAGTTATCTATTCTCGAGAATAGATAACTGCAAGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144933
VALIDATED
MED17 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 17
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1475s21c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1788s21c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144933.1-2144s21c1
Sequence:CCGGTTCACGGGAGCCCTGTTTAAACTCGAGTTTAAACAGGGCTCCCGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1004s21c1
Sequence:CCGGCCGGGAAGCCGTTCAGATTAACTCGAGTTAATCTGAACGGCTTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1961s21c1
Sequence:CCGGAGGCCGAAACTTCGTTTATAACTCGAGTTATAAACGAAGTTTCGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144933.1-2699s1c1
Sequence:CCGGGCCTTTGCATTCCACTTGAAACTCGAGTTTCAAGTGGAATGCAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1596s1c1
Sequence:CCGGCGGGTAATCATGTTGTCTCATCTCGAGATGAGACAACATGATTACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-861s1c1
Sequence:CCGGGCTCCAGACATTGGTGATCTTCTCGAGAAGATCACCAATGTCTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1788s1c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1475s1c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144933
VALIDATED
MED17 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 17
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1475s21c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1788s21c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144933.1-2144s21c1
Sequence:CCGGTTCACGGGAGCCCTGTTTAAACTCGAGTTTAAACAGGGCTCCCGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1004s21c1
Sequence:CCGGCCGGGAAGCCGTTCAGATTAACTCGAGTTAATCTGAACGGCTTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1961s21c1
Sequence:CCGGAGGCCGAAACTTCGTTTATAACTCGAGTTATAAACGAAGTTTCGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144933.1-2699s1c1
Sequence:CCGGGCCTTTGCATTCCACTTGAAACTCGAGTTTCAAGTGGAATGCAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1596s1c1
Sequence:CCGGCGGGTAATCATGTTGTCTCATCTCGAGATGAGACAACATGATTACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-861s1c1
Sequence:CCGGGCTCCAGACATTGGTGATCTTCTCGAGAAGATCACCAATGTCTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1788s1c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1475s1c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144933
VALIDATED
MED17 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 17
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1475s21c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1788s21c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313267    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144933.1-2144s21c1
Sequence:CCGGTTCACGGGAGCCCTGTTTAAACTCGAGTTTAAACAGGGCTCCCGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144933.1-1004s21c1
Sequence:CCGGCCGGGAAGCCGTTCAGATTAACTCGAGTTAATCTGAACGGCTTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144933.1-1961s21c1
Sequence:CCGGAGGCCGAAACTTCGTTTATAACTCGAGTTATAAACGAAGTTTCGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144933.1-2699s1c1
Sequence:CCGGGCCTTTGCATTCCACTTGAAACTCGAGTTTCAAGTGGAATGCAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1596s1c1
Sequence:CCGGCGGGTAATCATGTTGTCTCATCTCGAGATGAGACAACATGATTACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-861s1c1
Sequence:CCGGGCTCCAGACATTGGTGATCTTCTCGAGAAGATCACCAATGTCTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1788s1c1
Sequence:CCGGCCAAGTGGAGACTATGCGATTCTCGAGAATCGCATAGTCTCCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144933.1-1475s1c1
Sequence:CCGGTGTGTATGAGTCTAGTGTAAACTCGAGTTTACACTAGACTCATACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)