EMAIL THIS PAGE TO A FRIEND

MED18

mediator complex subunit 18

87 Gene Product Result for
Synonyms: p28b
UniProtKB ID: Q9BUE0, D3DPM1, Q9NXU9
Gene ID:
Human(54797) Summary: MED18 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]
Mouse(67219) mediator of RNA polymerase II transcription, subunit 18 homolog (yeast)
Zebrafish(393306) mediator of RNA polymerase II transcription, subunit 18 homolog (yeast)
cow(540695) mediator complex subunit 18
domestic cat(101086663) mediator complex subunit 18
dog(487334) mediator complex subunit 18
chicken(100857707) mediator complex subunit 18
fruit fly(31140) Mediator complex subunit 18
sheep(101103952) mediator complex subunit 18
naked mole-rat(101714395) mediator complex subunit 18
domestic guinea pig(100719327) mediator complex subunit 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127350 Rosetta Predictions human pricing
NM_017638 Rosetta Predictions human pricing
NM_026039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329164 predicted 564
2 SASI_Hs02_00329165 predicted 607
3 SASI_Hs02_00329166 predicted 565
4 SASI_Hs02_00329167 predicted 521
5 SASI_Hs02_00329168 predicted 323
6 SASI_Hs02_00329169 predicted 374
7 SASI_Hs02_00329170 predicted 602
8 SASI_Hs02_00329171 predicted 458
9 SASI_Hs02_00329172 predicted 369
10 SASI_Hs02_00329173 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350322 predicted 614
2 SASI_Hs02_00350323 predicted 667
3 SASI_Hs02_00350324 predicted 622
4 SASI_Hs02_00350325 predicted 578
5 SASI_Hs01_00019328 predicted 386
6 SASI_Hs02_00350326 predicted 430
7 SASI_Hs01_00019326 predicted 655
8 SASI_Hs02_00350327 predicted 511
9 SASI_Hs01_00019331 predicted 424
10 SASI_Hs02_00350328 predicted 572
11 SASI_Hs01_00019322 predicted 341
12 SASI_Hs01_00019323 predicted 322
13 SASI_Hs01_00019324 predicted 264
14 SASI_Hs01_00019325 predicted 220
15 SASI_Hs01_00019327 predicted 275
16 SASI_Hs01_00019329 predicted 299
17 SASI_Hs01_00019330 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064818 predicted 950
2 SASI_Mm01_00064819 predicted 637
3 SASI_Mm02_00329533 predicted 562
4 SASI_Mm01_00064821 predicted 908
5 SASI_Mm02_00329534 predicted 534
6 SASI_Mm01_00064822 predicted 586
7 SASI_Mm01_00064823 predicted 762
8 SASI_Mm01_00064824 predicted 199
9 SASI_Mm01_00064825 predicted 811
10 SASI_Mm01_00064826 predicted 199
11 SASI_Mm01_00064820 predicted 894
12 SASI_Mm01_00064827 predicted 517
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017638
VALIDATED
MED18 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 18
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-323s1c1
Sequence:CCGGCCTTCGTGGTTTGTGTGACAACTCGAGTTGTCACACAAACCACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-351s1c1
Sequence:CCGGCCTGAGACTTTCCTTGACCATCTCGAGATGGTCAAGGAAAGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-702s1c1
Sequence:CCGGCTCTCCTATCTCGTGGAATTACTCGAGTAATTCCACGAGATAGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-792s1c1
Sequence:CCGGCCTCTGGTTCACCTAGAGAAACTCGAGTTTCTCTAGGTGAACCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-479s1c1
Sequence:CCGGGCCAGAAATGGGAGACAAGAACTCGAGTTCTTGTCTCCCATTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-874s21c1
Sequence:CCGGTAAGAGGATCTGTCCACATTTCTCGAGAAATGTGGACAGATCCTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017638.2-613s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-550s21c1
Sequence:CCGGTGCGAAACTGCGTGGACATTGCTCGAGCAATGTCCACGCAGTTTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017638.2-1365s21c1
Sequence:CCGGATGACAGCCTTTCTATATTAACTCGAGTTAATATAGAAAGGCTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-740s21c1
Sequence:CCGGCTCCTATCTCGTGGAATTAAGCTCGAGCTTAATTCCACGAGATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-587s21c1
Sequence:CCGGCACCGACTTCTTGATGGAAATCTCGAGATTTCCATCAAGAAGTCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-670s21c1
Sequence:CCGGAGATTATGGTGTACAAGATTTCTCGAGAAATCTTGTACACCATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017638
VALIDATED
MED18 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 18
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-323s1c1
Sequence:CCGGCCTTCGTGGTTTGTGTGACAACTCGAGTTGTCACACAAACCACGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-351s1c1
Sequence:CCGGCCTGAGACTTTCCTTGACCATCTCGAGATGGTCAAGGAAAGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-702s1c1
Sequence:CCGGCTCTCCTATCTCGTGGAATTACTCGAGTAATTCCACGAGATAGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-792s1c1
Sequence:CCGGCCTCTGGTTCACCTAGAGAAACTCGAGTTTCTCTAGGTGAACCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-479s1c1
Sequence:CCGGGCCAGAAATGGGAGACAAGAACTCGAGTTCTTGTCTCCCATTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-874s21c1
Sequence:CCGGTAAGAGGATCTGTCCACATTTCTCGAGAAATGTGGACAGATCCTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017638.2-613s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-550s21c1
Sequence:CCGGTGCGAAACTGCGTGGACATTGCTCGAGCAATGTCCACGCAGTTTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017638.2-1365s21c1
Sequence:CCGGATGACAGCCTTTCTATATTAACTCGAGTTAATATAGAAAGGCTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-740s21c1
Sequence:CCGGCTCCTATCTCGTGGAATTAAGCTCGAGCTTAATTCCACGAGATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-587s21c1
Sequence:CCGGCACCGACTTCTTGATGGAAATCTCGAGATTTCCATCAAGAAGTCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-670s21c1
Sequence:CCGGAGATTATGGTGTACAAGATTTCTCGAGAAATCTTGTACACCATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017638
VALIDATED
MED18 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 18
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-323s1c1
Sequence:CCGGCCTTCGTGGTTTGTGTGACAACTCGAGTTGTCACACAAACCACGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-351s1c1
Sequence:CCGGCCTGAGACTTTCCTTGACCATCTCGAGATGGTCAAGGAAAGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-702s1c1
Sequence:CCGGCTCTCCTATCTCGTGGAATTACTCGAGTAATTCCACGAGATAGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017638.1-792s1c1
Sequence:CCGGCCTCTGGTTCACCTAGAGAAACTCGAGTTTCTCTAGGTGAACCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017638.1-479s1c1
Sequence:CCGGGCCAGAAATGGGAGACAAGAACTCGAGTTCTTGTCTCCCATTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-874s21c1
Sequence:CCGGTAAGAGGATCTGTCCACATTTCTCGAGAAATGTGGACAGATCCTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017638.2-613s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-550s21c1
Sequence:CCGGTGCGAAACTGCGTGGACATTGCTCGAGCAATGTCCACGCAGTTTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017638.2-1365s21c1
Sequence:CCGGATGACAGCCTTTCTATATTAACTCGAGTTAATATAGAAAGGCTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-740s21c1
Sequence:CCGGCTCCTATCTCGTGGAATTAAGCTCGAGCTTAATTCCACGAGATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-587s21c1
Sequence:CCGGCACCGACTTCTTGATGGAAATCTCGAGATTTCCATCAAGAAGTCGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017638.2-670s21c1
Sequence:CCGGAGATTATGGTGTACAAGATTTCTCGAGAAATCTTGTACACCATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026039
MED18 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-635s1c1
Sequence:CCGGCCCTCTCCTATCTTGTGGAATCTCGAGATTCCACAAGATAGGAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-185s1c1
Sequence:CCGGGCACCATTAACATGATGGAGTCTCGAGACTCCATCATGTTAATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-690s1c1
Sequence:CCGGCTCTGATGACATGAGGAACTTCTCGAGAAGTTCCTCATGTCATCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-564s1c1
Sequence:CCGGCATGAAGGTTGTGGTGTACAACTCGAGTTGTACACCACAACCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026039.2-1392s1c1
Sequence:CCGGGAATTAAAGGCGTGCGATAACCTCGAGGTTATCGCACGCCTTTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-692s21c1
Sequence:CCGGCTGATGACATGAGGAACTTTGCTCGAGCAAAGTTCCTCATGTCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-639s21c1
Sequence:CCGGCTCCTATCTTGTGGAATTAAGCTCGAGCTTAATTCCACAAGATAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-402s21c1
Sequence:CCGGATACCTGGGACAGCCCGAAATCTCGAGATTTCGGGCTGTCCCAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-512s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026039.2-1015s21c1
Sequence:CCGGGTGCCTGCAAGGTCCTTATTACTCGAGTAATAAGGACCTTGCAGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026039
MED18 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-635s1c1
Sequence:CCGGCCCTCTCCTATCTTGTGGAATCTCGAGATTCCACAAGATAGGAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-185s1c1
Sequence:CCGGGCACCATTAACATGATGGAGTCTCGAGACTCCATCATGTTAATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-690s1c1
Sequence:CCGGCTCTGATGACATGAGGAACTTCTCGAGAAGTTCCTCATGTCATCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-564s1c1
Sequence:CCGGCATGAAGGTTGTGGTGTACAACTCGAGTTGTACACCACAACCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026039.2-1392s1c1
Sequence:CCGGGAATTAAAGGCGTGCGATAACCTCGAGGTTATCGCACGCCTTTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-692s21c1
Sequence:CCGGCTGATGACATGAGGAACTTTGCTCGAGCAAAGTTCCTCATGTCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-639s21c1
Sequence:CCGGCTCCTATCTTGTGGAATTAAGCTCGAGCTTAATTCCACAAGATAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-402s21c1
Sequence:CCGGATACCTGGGACAGCCCGAAATCTCGAGATTTCGGGCTGTCCCAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-512s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026039.2-1015s21c1
Sequence:CCGGGTGCCTGCAAGGTCCTTATTACTCGAGTAATAAGGACCTTGCAGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026039
MED18 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-635s1c1
Sequence:CCGGCCCTCTCCTATCTTGTGGAATCTCGAGATTCCACAAGATAGGAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-185s1c1
Sequence:CCGGGCACCATTAACATGATGGAGTCTCGAGACTCCATCATGTTAATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180276    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-690s1c1
Sequence:CCGGCTCTGATGACATGAGGAACTTCTCGAGAAGTTCCTCATGTCATCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026039.2-564s1c1
Sequence:CCGGCATGAAGGTTGTGGTGTACAACTCGAGTTGTACACCACAACCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217668    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026039.2-1392s1c1
Sequence:CCGGGAATTAAAGGCGTGCGATAACCTCGAGGTTATCGCACGCCTTTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-692s21c1
Sequence:CCGGCTGATGACATGAGGAACTTTGCTCGAGCAAAGTTCCTCATGTCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-639s21c1
Sequence:CCGGCTCCTATCTTGTGGAATTAAGCTCGAGCTTAATTCCACAAGATAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-402s21c1
Sequence:CCGGATACCTGGGACAGCCCGAAATCTCGAGATTTCGGGCTGTCCCAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026039.2-512s21c1
Sequence:CCGGTCCGCATGGACCATGAGTTTGCTCGAGCAAACTCATGGTCCATGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245390    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026039.2-1015s21c1
Sequence:CCGGGTGCCTGCAAGGTCCTTATTACTCGAGTAATAAGGACCTTGCAGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)