EMAIL THIS PAGE TO A FRIEND

MED19

mediator complex subunit 19

89 Gene Product Result for
Synonyms: DT2P1G7 LCMR1
UniProtKB ID: A0JLT2, Q8IV02, Q8IZD1
Gene ID:
Human(219541) Summary: MED19 is a component of the Mediator complex, which is a coactivator for DNA-binding factors that activate transcription via RNA polymerase II (Sato et al., 2003 [PubMed 12584197]
Mouse(381379) mediator of RNA polymerase II transcription, subunit 19 homolog (yeast)
Rat(311165) mediator complex subunit 19
domestic guinea pig(100721036) mediator complex subunit 19
naked mole-rat(101721250) mediator complex subunit 19
sheep(101122216) mediator complex subunit 19
fruit fly(39987) Mediator complex subunit 19
chicken(428854) mediator complex subunit 19
dog(612925) mediator complex subunit 19
cow(509245) mediator complex subunit 19
domestic cat(101091729) mediator complex subunit 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025885 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025885 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025885 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153450 Rosetta Predictions human pricing
NM_001107741 Rosetta Predictions rat pricing
NM_025885 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128441 predicted 597
2 SASI_Hs01_00128442 predicted 255
3 SASI_Hs01_00128443 predicted 497
4 SASI_Hs01_00128449 predicted 283
5 SASI_Hs01_00128444 predicted 431
6 SASI_Hs01_00128445 predicted 273
7 SASI_Hs01_00128446 predicted 280
8 SASI_Hs01_00128447 predicted 243
9 SASI_Hs02_00367293 predicted 20
10 SASI_Hs01_00128450 predicted 938
11 SASI_Hs01_00128448 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231815 predicted 280
2 SASI_Rn02_00231816 predicted 306
3 SASI_Rn02_00231817 predicted 243
4 SASI_Rn02_00231818 predicted 1244
5 SASI_Rn02_00231819 predicted 428
6 SASI_Rn02_00231820 predicted 1101
7 SASI_Rn02_00231821 predicted 773
8 SASI_Rn02_00231822 predicted 1158
9 SASI_Rn02_00231823 predicted 812
10 SASI_Rn02_00231824 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025885 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181447 predicted 253
2 SASI_Mm01_00181448 predicted 218
3 SASI_Mm01_00181449 predicted 257
4 SASI_Mm01_00181451 predicted 221
5 SASI_Mm01_00181452 predicted 253
6 SASI_Mm01_00181453 predicted 325
7 SASI_Mm01_00181450 predicted 325
8 SASI_Mm01_00181454 predicted 400
9 SASI_Mm01_00181456 predicted 1078
10 SASI_Mm02_00329221 predicted 1113
11 SASI_Mm01_00181455 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153450
VALIDATED
MED19 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-616s21c1
Sequence:CCGGTGGAGCTCTGGACTCCTAAATCTCGAGATTTAGGAGTCCAGAGCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-761s21c1
Sequence:CCGGTAGTCTTCAGTGGTTCATAACCTCGAGGTTATGAACCACTGAAGACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-590s21c1
Sequence:CCGGCCAGGTAAACCCAGTTAAGTTCTCGAGAACTTAACTGGGTTTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-926s21c1
Sequence:CCGGAGGTAGAGTAGAGGCCTATTGCTCGAGCAATAGGCCTCTACTCTACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153450.1-424s1c1
Sequence:CCGGCCCTATTCTCAGTAGCTCTTTCTCGAGAAAGAGCTACTGAGAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-265s1c1
Sequence:CCGGGAATCTGATCACACACTACAACTCGAGTTGTAGTGTGTGATCAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-433s1c1
Sequence:CCGGCAGTAGCTCTTTCAATCCTATCTCGAGATAGGATTGAAAGAGCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-373s1c1
Sequence:CCGGTCTGCCTGGTTCCCATGATAACTCGAGTTATCATGGGAACCAGGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-505s21c1
Sequence:CCGGGCAGTGTCGTCTGATGCATATCTCGAGATATGCATCAGACGACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-529s1c1
Sequence:CCGGGCCTCCCAAGAAGAAGAATAACTCGAGTTATTCTTCTTCTTGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153450
VALIDATED
MED19 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-616s21c1
Sequence:CCGGTGGAGCTCTGGACTCCTAAATCTCGAGATTTAGGAGTCCAGAGCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-761s21c1
Sequence:CCGGTAGTCTTCAGTGGTTCATAACCTCGAGGTTATGAACCACTGAAGACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-590s21c1
Sequence:CCGGCCAGGTAAACCCAGTTAAGTTCTCGAGAACTTAACTGGGTTTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-926s21c1
Sequence:CCGGAGGTAGAGTAGAGGCCTATTGCTCGAGCAATAGGCCTCTACTCTACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153450.1-424s1c1
Sequence:CCGGCCCTATTCTCAGTAGCTCTTTCTCGAGAAAGAGCTACTGAGAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-265s1c1
Sequence:CCGGGAATCTGATCACACACTACAACTCGAGTTGTAGTGTGTGATCAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-433s1c1
Sequence:CCGGCAGTAGCTCTTTCAATCCTATCTCGAGATAGGATTGAAAGAGCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-373s1c1
Sequence:CCGGTCTGCCTGGTTCCCATGATAACTCGAGTTATCATGGGAACCAGGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-505s21c1
Sequence:CCGGGCAGTGTCGTCTGATGCATATCTCGAGATATGCATCAGACGACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-529s1c1
Sequence:CCGGGCCTCCCAAGAAGAAGAATAACTCGAGTTATTCTTCTTCTTGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153450
VALIDATED
MED19 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-616s21c1
Sequence:CCGGTGGAGCTCTGGACTCCTAAATCTCGAGATTTAGGAGTCCAGAGCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-761s21c1
Sequence:CCGGTAGTCTTCAGTGGTTCATAACCTCGAGGTTATGAACCACTGAAGACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-590s21c1
Sequence:CCGGCCAGGTAAACCCAGTTAAGTTCTCGAGAACTTAACTGGGTTTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153450.1-926s21c1
Sequence:CCGGAGGTAGAGTAGAGGCCTATTGCTCGAGCAATAGGCCTCTACTCTACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153450.1-424s1c1
Sequence:CCGGCCCTATTCTCAGTAGCTCTTTCTCGAGAAAGAGCTACTGAGAATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-265s1c1
Sequence:CCGGGAATCTGATCACACACTACAACTCGAGTTGTAGTGTGTGATCAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-433s1c1
Sequence:CCGGCAGTAGCTCTTTCAATCCTATCTCGAGATAGGATTGAAAGAGCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-373s1c1
Sequence:CCGGTCTGCCTGGTTCCCATGATAACTCGAGTTATCATGGGAACCAGGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153450.1-505s21c1
Sequence:CCGGGCAGTGTCGTCTGATGCATATCTCGAGATATGCATCAGACGACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_153450.1-529s1c1
Sequence:CCGGGCCTCCCAAGAAGAAGAATAACTCGAGTTATTCTTCTTCTTGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025885
VALIDATED
MED19 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 19
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025885.1-1880s1c1
Sequence:CCGGCCAGAGAATGAGGTTTCTCTTCTCGAGAAGAGAAACCTCATTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-516s1c1
Sequence:CCGGGATGCATATTCAGCCACCCAACTCGAGTTGGGTGGCTGAATATGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-297s1c1
Sequence:CCGGCTATAATAAGTTCTGTGGGAACTCGAGTTCCCACAGAACTTATTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-213s21c1
Sequence:CCGGTTCTACCTGATGCGGGAATTGCTCGAGCAATTCCCGCATCAGGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-1365s21c1
Sequence:CCGGTGAGCCACAATCACGGATATACTCGAGTATATCCGTGATTGTGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-250s21c1
Sequence:CCGGTGACGGGCAGCACCAATTTAACTCGAGTTAAATTGGTGCTGCCCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-283s21c1
Sequence:CCGGACCTGGAGCAGGCCTATAATACTCGAGTATTATAGGCCTGCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-504s21c1
Sequence:CCGGCAGTGTCGTCTGATGCATATTCTCGAGAATATGCATCAGACGACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025885
VALIDATED
MED19 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 19
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025885.1-1880s1c1
Sequence:CCGGCCAGAGAATGAGGTTTCTCTTCTCGAGAAGAGAAACCTCATTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-516s1c1
Sequence:CCGGGATGCATATTCAGCCACCCAACTCGAGTTGGGTGGCTGAATATGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-297s1c1
Sequence:CCGGCTATAATAAGTTCTGTGGGAACTCGAGTTCCCACAGAACTTATTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-213s21c1
Sequence:CCGGTTCTACCTGATGCGGGAATTGCTCGAGCAATTCCCGCATCAGGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-1365s21c1
Sequence:CCGGTGAGCCACAATCACGGATATACTCGAGTATATCCGTGATTGTGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-250s21c1
Sequence:CCGGTGACGGGCAGCACCAATTTAACTCGAGTTAAATTGGTGCTGCCCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-283s21c1
Sequence:CCGGACCTGGAGCAGGCCTATAATACTCGAGTATTATAGGCCTGCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-504s21c1
Sequence:CCGGCAGTGTCGTCTGATGCATATTCTCGAGAATATGCATCAGACGACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025885
VALIDATED
MED19 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 19
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025885.1-1880s1c1
Sequence:CCGGCCAGAGAATGAGGTTTCTCTTCTCGAGAAGAGAAACCTCATTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-516s1c1
Sequence:CCGGGATGCATATTCAGCCACCCAACTCGAGTTGGGTGGCTGAATATGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025885.1-297s1c1
Sequence:CCGGCTATAATAAGTTCTGTGGGAACTCGAGTTCCCACAGAACTTATTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-213s21c1
Sequence:CCGGTTCTACCTGATGCGGGAATTGCTCGAGCAATTCCCGCATCAGGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-1365s21c1
Sequence:CCGGTGAGCCACAATCACGGATATACTCGAGTATATCCGTGATTGTGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-250s21c1
Sequence:CCGGTGACGGGCAGCACCAATTTAACTCGAGTTAAATTGGTGCTGCCCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-283s21c1
Sequence:CCGGACCTGGAGCAGGCCTATAATACTCGAGTATTATAGGCCTGCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025885.2-504s21c1
Sequence:CCGGCAGTGTCGTCTGATGCATATTCTCGAGAATATGCATCAGACGACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)