EMAIL THIS PAGE TO A FRIEND

MED1

mediator complex subunit 1

197 Gene Product Result for
Synonyms: CRSP1 CRSP200 DRIP205 DRIP230 PBP PPARBP PPARGBP RB18A TRAP220 TRIP2
Gene ID:
Human(5469) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
Mouse(19014) mediator complex subunit 1
Rat(497991) mediator complex subunit 1
Zebrafish(571519) mediator complex subunit 1
dog(480533) mediator complex subunit 1
Horse(100054967) mediator complex subunit 1
cow(520734) mediator complex subunit 1
domestic cat(101090305) mediator complex subunit 1
chicken(420004) mediator complex subunit 1
fruit fly(40403) Mediator complex subunit 1
domestic guinea pig(100722971) mediator complex subunit 1
naked mole-rat(101711966) mediator complex subunit 1
sheep(101102404) mediator complex subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32462 Anti-LOC391804 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, mouse, rat, chicken, bovine, human
western blot pricing
SAB4502265 Anti-MED1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
HPA052818 Anti-MED1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
P0994 Anti-Peroxisome Proliferator Activated Receptor antibody produced in rabbit whole antiserum rat, mouse
immunoprecipitation (IP), western blot pricing
SAB4503976 Anti-phospho-PPAR-BP (pThr1457) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301519 Anti-phospho-PPAR-BP (pThr1457) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4502264 Anti-PPAR-BP antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence pricing
SAB1411807 ANTI-PPARBP antibody produced in mouse clone 1G4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411808 ANTI-PPARBP antibody produced in mouse clone 2G1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411809 ANTI-PPARBP antibody produced in mouse clone 2H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1411810 ANTI-PPARBP antibody produced in mouse clone 3F6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0300 Goat anti-CRSP1/TRAP220 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation (IP), proximity ligation assay, western blot pricing
WH0005469M1 Monoclonal Anti-PPARBP antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404231 Monoclonal Anti-PPARBP antibody produced in mouse clone 1G3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0142 Rabbit anti-CRSP1/TRAP220 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, rabbit, chicken, turkey, human, guinea pig, horse, dog, rat, bovine, mouse, pig
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004774 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002851 MISSION® esiRNA esiRNA targeting human PPARBP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004774 Rosetta Predictions human pricing
NM_001134361 Rosetta Predictions rat pricing
NM_001080118 Rosetta Predictions mouse pricing
NM_013634 Rosetta Predictions mouse pricing
NM_134027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089551 predicted 4475
2 SASI_Hs01_00089552 predicted 2527
3 SASI_Hs01_00089553 predicted 4238
4 SASI_Hs02_00338281 predicted 987
5 SASI_Hs01_00089555 predicted 3316
6 SASI_Hs01_00089556 predicted 1014
7 SASI_Hs01_00089557 predicted 3555
8 SASI_Hs01_00089558 predicted 2975
9 SASI_Hs01_00089559 predicted 3749
10 SASI_Hs02_00338282 predicted 3581
11 SASI_Hs01_00089554 predicted 1609
12 SASI_Hs01_00089560 predicted 1856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134361 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256229 predicted 1480
2 SASI_Rn02_00256230 predicted 1513
3 SASI_Rn02_00256231 predicted 4831
4 SASI_Rn02_00256232 predicted 780
5 SASI_Rn02_00256233 predicted 1435
6 SASI_Rn02_00256234 predicted 3939
7 SASI_Rn02_00256235 predicted 668
8 SASI_Rn02_00256236 predicted 3778
9 SASI_Rn02_00256237 predicted 2072
10 SASI_Rn02_00256238 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293283 predicted 1619
2 SASI_Mm02_00293284 predicted 663
3 SASI_Mm02_00293285 predicted 434
4 SASI_Mm02_00293286 predicted 1261
5 SASI_Mm02_00293287 predicted 1624
6 SASI_Mm02_00293288 predicted 1574
7 SASI_Mm02_00293289 predicted 1540
8 SASI_Mm02_00293290 predicted 1537
9 SASI_Mm02_00293291 predicted 1576
10 SASI_Mm02_00293292 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069662 predicted 1491
2 SASI_Mm02_00322420 predicted 522
3 SASI_Mm02_00322421 predicted 299
4 SASI_Mm02_00322422 predicted 1132
5 SASI_Mm01_00069664 predicted 1480
6 SASI_Mm01_00069666 predicted 1439
7 SASI_Mm01_00069668 predicted 1413
8 SASI_Mm01_00069669 predicted 1404
9 SASI_Mm02_00322423 predicted 1435
10 SASI_Mm02_00322424 predicted 1442
11 SASI_Mm01_00069663 predicted 1463
12 SASI_Mm01_00069665 predicted 1420
13 SASI_Mm01_00069667 predicted 1284
14 SASI_Mm01_00069670 predicted 1235
15 SASI_Mm01_00069671 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020296 predicted 1627
2 SASI_Mm02_00339188 predicted 664
3 SASI_Mm02_00339189 predicted 433
4 SASI_Mm02_00339190 predicted 1264
5 SASI_Mm01_00020298 predicted 1617
6 SASI_Mm01_00020300 predicted 1573
7 SASI_Mm01_00020302 predicted 1544
8 SASI_Mm01_00020303 predicted 1542
9 SASI_Mm02_00339191 predicted 1576
10 SASI_Mm02_00339192 predicted 1578
11 SASI_Mm01_00020297 predicted 1562
12 SASI_Mm01_00020299 predicted 1529
13 SASI_Mm01_00020301 predicted 1393
14 SASI_Mm01_00020304 predicted 1341
15 SASI_Mm01_00020305 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013634
VALIDATED
MED1 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-3256s21c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-375s21c1
Sequence:CCGGGTGTTACATCACGTCAGATATCTCGAGATATCTGACGTGATGTAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-186s21c1
Sequence:CCGGTAAGCTTGTGCGTCAAGTAATCTCGAGATTACTTGACGCACAAGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-2766s21c1
Sequence:CCGGATTTGCATCTCAGGCATTAAACTCGAGTTTAATGCCTGAGATGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013634.2-4920s21c1
Sequence:CCGGTACACCAAGCTGGGTACATTTCTCGAGAAATGTACCCAGCTTGGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-4071s1c1
Sequence:CCGGCGCAAGCACAAATTCTTCTAACTCGAGTTAGAAGAATTTGTGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-2037s1c1
Sequence:CCGGCCAGGATTTCTCAACCCTTTACTCGAGTAAAGGGTTGAGAAATCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013634.1-3256s1c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013634.1-4827s1c1
Sequence:CCGGCCAGAGGAGAAACTAATGATACTCGAGTATCATTAGTTTCTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-297s1c1
Sequence:CCGGGCCAGCAATGACTGATCGTTTCTCGAGAAACGATCAGTCATTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013634
VALIDATED
MED1 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-3256s21c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-375s21c1
Sequence:CCGGGTGTTACATCACGTCAGATATCTCGAGATATCTGACGTGATGTAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-186s21c1
Sequence:CCGGTAAGCTTGTGCGTCAAGTAATCTCGAGATTACTTGACGCACAAGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-2766s21c1
Sequence:CCGGATTTGCATCTCAGGCATTAAACTCGAGTTTAATGCCTGAGATGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013634.2-4920s21c1
Sequence:CCGGTACACCAAGCTGGGTACATTTCTCGAGAAATGTACCCAGCTTGGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-4071s1c1
Sequence:CCGGCGCAAGCACAAATTCTTCTAACTCGAGTTAGAAGAATTTGTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-2037s1c1
Sequence:CCGGCCAGGATTTCTCAACCCTTTACTCGAGTAAAGGGTTGAGAAATCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013634.1-3256s1c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013634.1-4827s1c1
Sequence:CCGGCCAGAGGAGAAACTAATGATACTCGAGTATCATTAGTTTCTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-297s1c1
Sequence:CCGGGCCAGCAATGACTGATCGTTTCTCGAGAAACGATCAGTCATTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013634
VALIDATED
MED1 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-3256s21c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-375s21c1
Sequence:CCGGGTGTTACATCACGTCAGATATCTCGAGATATCTGACGTGATGTAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013634.2-186s21c1
Sequence:CCGGTAAGCTTGTGCGTCAAGTAATCTCGAGATTACTTGACGCACAAGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013634.2-2766s21c1
Sequence:CCGGATTTGCATCTCAGGCATTAAACTCGAGTTTAATGCCTGAGATGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013634.2-4920s21c1
Sequence:CCGGTACACCAAGCTGGGTACATTTCTCGAGAAATGTACCCAGCTTGGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-4071s1c1
Sequence:CCGGCGCAAGCACAAATTCTTCTAACTCGAGTTAGAAGAATTTGTGCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-2037s1c1
Sequence:CCGGCCAGGATTTCTCAACCCTTTACTCGAGTAAAGGGTTGAGAAATCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013634.1-3256s1c1
Sequence:CCGGCCCAAGATTACCATTCAGATTCTCGAGAATCTGAATGGTAATCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013634.1-4827s1c1
Sequence:CCGGCCAGAGGAGAAACTAATGATACTCGAGTATCATTAGTTTCTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013634.1-297s1c1
Sequence:CCGGGCCAGCAATGACTGATCGTTTCTCGAGAAACGATCAGTCATTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004774
VALIDATED
MED1 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-3536s1c1
Sequence:CCGGGCAGTAAATCAGAAGGTTCATCTCGAGATGAACCTTCTGATTTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-4595s1c1
Sequence:CCGGCCTCCATAGCAGAGAAATCTTCTCGAGAAGATTTCTCTGCTATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-2166s1c1
Sequence:CCGGCCTTTATGGAAGCAGCCCTTTCTCGAGAAAGGGCTGCTTCCATAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-391s1c1
Sequence:CCGGGCTCTCAAAGTAACATCTTTACTCGAGTAAAGATGTTACTTTGAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-1394s1c1
Sequence:CCGGGCCGAGTTCCTCTTATCCTAACTCGAGTTAGGATAAGAGGAACTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004774
VALIDATED
MED1 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-3536s1c1
Sequence:CCGGGCAGTAAATCAGAAGGTTCATCTCGAGATGAACCTTCTGATTTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-4595s1c1
Sequence:CCGGCCTCCATAGCAGAGAAATCTTCTCGAGAAGATTTCTCTGCTATGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-2166s1c1
Sequence:CCGGCCTTTATGGAAGCAGCCCTTTCTCGAGAAAGGGCTGCTTCCATAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-391s1c1
Sequence:CCGGGCTCTCAAAGTAACATCTTTACTCGAGTAAAGATGTTACTTTGAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-1394s1c1
Sequence:CCGGGCCGAGTTCCTCTTATCCTAACTCGAGTTAGGATAAGAGGAACTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004774
VALIDATED
MED1 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-3536s1c1
Sequence:CCGGGCAGTAAATCAGAAGGTTCATCTCGAGATGAACCTTCTGATTTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-4595s1c1
Sequence:CCGGCCTCCATAGCAGAGAAATCTTCTCGAGAAGATTTCTCTGCTATGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-2166s1c1
Sequence:CCGGCCTTTATGGAAGCAGCCCTTTCTCGAGAAAGGGCTGCTTCCATAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004774.2-391s1c1
Sequence:CCGGGCTCTCAAAGTAACATCTTTACTCGAGTAAAGATGTTACTTTGAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004774.2-1394s1c1
Sequence:CCGGGCCGAGTTCCTCTTATCCTAACTCGAGTTAGGATAAGAGGAACTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)