EMAIL THIS PAGE TO A FRIEND

MED20

mediator complex subunit 20

72 Gene Product Result for
Synonyms: PRO0213 TRFP
UniProtKB ID: Q9H944, O95821, Q5T8J4, Q9Y429
Gene ID:
Human(9477) Summary: MED20 is a subunit of the Mediator complex, a multiprotein coactivator of RNA transcription that interacts with DNA-bound transcriptional activators, RNA polymerase II (see MIM 180660), and general initiation factors (Sato et al., 2003 [PubMed 14576168]
Mouse(56771) mediator complex subunit 20
Rat(316209) mediator complex subunit 20
Zebrafish(445191) mediator complex subunit 20
cow(540294) mediator complex subunit 20
domestic cat(101100811) mediator complex subunit 20
dog(481796) mediator complex subunit 20
chicken(419926) mediator complex subunit 20
fruit fly(43952) Mediator complex subunit 20
Goat(100861328) mediator complex subunit 20
sheep(101107557) mediator complex subunit 20
naked mole-rat(101709831) mediator complex subunit 20
domestic guinea pig(100715715) mediator complex subunit 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068561 MISSION® esiRNA esiRNA human TRFP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004275 Rosetta Predictions human pricing
NM_001013178 Rosetta Predictions rat pricing
NM_020048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083710 predicted 852
2 SASI_Hs01_00083711 predicted 264
3 SASI_Hs01_00083712 predicted 989
4 SASI_Hs01_00083713 predicted 353
5 SASI_Hs01_00083714 predicted 365
6 SASI_Hs01_00083715 predicted 239
7 SASI_Hs01_00083716 predicted 305
8 SASI_Hs01_00083717 predicted 662
9 SASI_Hs01_00083718 predicted 489
10 SASI_Hs02_00337257 predicted 573
11 SASI_Hs01_00083719 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049094 predicted 840
2 SASI_Rn01_00049095 predicted 1019
3 SASI_Rn01_00049097 predicted 288
4 SASI_Rn01_00049099 predicted 343
5 SASI_Rn01_00049101 predicted 1185
6 SASI_Rn02_00200933 predicted 893
7 SASI_Rn01_00049102 predicted 644
8 SASI_Rn01_00049103 predicted 671
9 SASI_Rn02_00200934 predicted 899
10 SASI_Rn02_00200935 predicted 1009
11 SASI_Rn01_00049096 predicted 336
12 SASI_Rn01_00049098 predicted 284
13 SASI_Rn01_00049100 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185925 predicted 912
2 SASI_Mm01_00185926 predicted 277
3 SASI_Mm01_00185927 predicted 518
4 SASI_Mm01_00185928 predicted 742
5 SASI_Mm01_00185929 predicted 445
6 SASI_Mm01_00185930 predicted 639
7 SASI_Mm01_00185931 predicted 417
8 SASI_Mm01_00185932 predicted 192
9 SASI_Mm01_00185933 predicted 269
10 SASI_Mm01_00185934 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004275
MED20 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 20
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004275.2-943s1c1
Sequence:CCGGCCTGTCCTCAAGAATGGTAATCTCGAGATTACCATTCTTGAGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-170s1c1
Sequence:CCGGGCAGAGAAGCAAGGAACATTTCTCGAGAAATGTTCCTTGCTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-256s1c1
Sequence:CCGGGCTGATGTATGTGATGCACAACTCGAGTTGTGCATCACATACATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-335s1c1
Sequence:CCGGGACACCAACTTTGATGTGCTTCTCGAGAAGCACATCAAAGTTGGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-593s1c1
Sequence:CCGGGCAGTGTTTGGGAACAGACATCTCGAGATGTCTGTTCCCAAACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1028s21c1
Sequence:CCGGGTTTGGACCTTGCCTCCTTTACTCGAGTAAAGGAGGCAAGGTCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1242s21c1
Sequence:CCGGCACAACTGGTTTGATAGTTACCTCGAGGTAACTATCAAACCAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-359s21c1
Sequence:CCGGGAGAATGGCCCTTGCCTTATTCTCGAGAATAAGGCAAGGGCCATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-329s21c1
Sequence:CCGGGAGTACCCATTGAGCTGTTTCCTCGAGGAAACAGCTCAATGGGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-968s21c1
Sequence:CCGGACTCCGTGCCTTACTGGATTTCTCGAGAAATCCAGTAAGGCACGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-184s21c1
Sequence:CCGGAGAGCTCCTTACCCGGAAATTCTCGAGAATTTCCGGGTAAGGAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004275
MED20 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 20
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004275.2-943s1c1
Sequence:CCGGCCTGTCCTCAAGAATGGTAATCTCGAGATTACCATTCTTGAGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-170s1c1
Sequence:CCGGGCAGAGAAGCAAGGAACATTTCTCGAGAAATGTTCCTTGCTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-256s1c1
Sequence:CCGGGCTGATGTATGTGATGCACAACTCGAGTTGTGCATCACATACATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-335s1c1
Sequence:CCGGGACACCAACTTTGATGTGCTTCTCGAGAAGCACATCAAAGTTGGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-593s1c1
Sequence:CCGGGCAGTGTTTGGGAACAGACATCTCGAGATGTCTGTTCCCAAACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1028s21c1
Sequence:CCGGGTTTGGACCTTGCCTCCTTTACTCGAGTAAAGGAGGCAAGGTCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1242s21c1
Sequence:CCGGCACAACTGGTTTGATAGTTACCTCGAGGTAACTATCAAACCAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-359s21c1
Sequence:CCGGGAGAATGGCCCTTGCCTTATTCTCGAGAATAAGGCAAGGGCCATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-329s21c1
Sequence:CCGGGAGTACCCATTGAGCTGTTTCCTCGAGGAAACAGCTCAATGGGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-968s21c1
Sequence:CCGGACTCCGTGCCTTACTGGATTTCTCGAGAAATCCAGTAAGGCACGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-184s21c1
Sequence:CCGGAGAGCTCCTTACCCGGAAATTCTCGAGAATTTCCGGGTAAGGAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004275
MED20 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 20
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004275.2-943s1c1
Sequence:CCGGCCTGTCCTCAAGAATGGTAATCTCGAGATTACCATTCTTGAGGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-170s1c1
Sequence:CCGGGCAGAGAAGCAAGGAACATTTCTCGAGAAATGTTCCTTGCTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-256s1c1
Sequence:CCGGGCTGATGTATGTGATGCACAACTCGAGTTGTGCATCACATACATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-335s1c1
Sequence:CCGGGACACCAACTTTGATGTGCTTCTCGAGAAGCACATCAAAGTTGGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004275.2-593s1c1
Sequence:CCGGGCAGTGTTTGGGAACAGACATCTCGAGATGTCTGTTCCCAAACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432833    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1028s21c1
Sequence:CCGGGTTTGGACCTTGCCTCCTTTACTCGAGTAAAGGAGGCAAGGTCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-1242s21c1
Sequence:CCGGCACAACTGGTTTGATAGTTACCTCGAGGTAACTATCAAACCAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-359s21c1
Sequence:CCGGGAGAATGGCCCTTGCCTTATTCTCGAGAATAAGGCAAGGGCCATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-329s21c1
Sequence:CCGGGAGTACCCATTGAGCTGTTTCCTCGAGGAAACAGCTCAATGGGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004275.3-968s21c1
Sequence:CCGGACTCCGTGCCTTACTGGATTTCTCGAGAAATCCAGTAAGGCACGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004275.3-184s21c1
Sequence:CCGGAGAGCTCCTTACCCGGAAATTCTCGAGAATTTCCGGGTAAGGAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020048
VALIDATED
MED20 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 20
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-607s1c1
Sequence:CCGGGTATTTGGGAACAGACACGATCTCGAGATCGTGTCTGTTCCCAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-660s1c1
Sequence:CCGGGTACATGGAACTCTTCAACAACTCGAGTTGTTGAAGAGTTCCATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020048.2-267s1c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-654s1c1
Sequence:CCGGGATACAGTACATGGAACTCTTCTCGAGAAGAGTTCCATGTACTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-181s1c1
Sequence:CCGGGCAGAGAAACAAGGGACATTTCTCGAGAAATGTCCCTTGTTTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1602s1c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1315s1c1
Sequence:CCGGCCTATGTCTTACTGTTCCTTACTCGAGTAAGGAACAGTAAGACATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-145s21c1
Sequence:CCGGTGGAGCTCCTCACCAAGAAACCTCGAGGTTTCTTGGTGAGGAGCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-322s21c1
Sequence:CCGGAGAATGGCCCTTGCCTCATTGCTCGAGCAATGAGGCAAGGGCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-616s21c1
Sequence:CCGGACAGACACGATGCGGTCTATGCTCGAGCATAGACCGCATCGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020048.3-1601s21c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-266s21c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020048
VALIDATED
MED20 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 20
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-607s1c1
Sequence:CCGGGTATTTGGGAACAGACACGATCTCGAGATCGTGTCTGTTCCCAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-660s1c1
Sequence:CCGGGTACATGGAACTCTTCAACAACTCGAGTTGTTGAAGAGTTCCATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020048.2-267s1c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-654s1c1
Sequence:CCGGGATACAGTACATGGAACTCTTCTCGAGAAGAGTTCCATGTACTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-181s1c1
Sequence:CCGGGCAGAGAAACAAGGGACATTTCTCGAGAAATGTCCCTTGTTTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1602s1c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1315s1c1
Sequence:CCGGCCTATGTCTTACTGTTCCTTACTCGAGTAAGGAACAGTAAGACATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-145s21c1
Sequence:CCGGTGGAGCTCCTCACCAAGAAACCTCGAGGTTTCTTGGTGAGGAGCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-322s21c1
Sequence:CCGGAGAATGGCCCTTGCCTCATTGCTCGAGCAATGAGGCAAGGGCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-616s21c1
Sequence:CCGGACAGACACGATGCGGTCTATGCTCGAGCATAGACCGCATCGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020048.3-1601s21c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-266s21c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020048
VALIDATED
MED20 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 20
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-607s1c1
Sequence:CCGGGTATTTGGGAACAGACACGATCTCGAGATCGTGTCTGTTCCCAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020048.2-660s1c1
Sequence:CCGGGTACATGGAACTCTTCAACAACTCGAGTTGTTGAAGAGTTCCATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020048.2-267s1c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-654s1c1
Sequence:CCGGGATACAGTACATGGAACTCTTCTCGAGAAGAGTTCCATGTACTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020048.2-181s1c1
Sequence:CCGGGCAGAGAAACAAGGGACATTTCTCGAGAAATGTCCCTTGTTTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1602s1c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020048.2-1315s1c1
Sequence:CCGGCCTATGTCTTACTGTTCCTTACTCGAGTAAGGAACAGTAAGACATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-145s21c1
Sequence:CCGGTGGAGCTCCTCACCAAGAAACCTCGAGGTTTCTTGGTGAGGAGCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-322s21c1
Sequence:CCGGAGAATGGCCCTTGCCTCATTGCTCGAGCAATGAGGCAAGGGCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-616s21c1
Sequence:CCGGACAGACACGATGCGGTCTATGCTCGAGCATAGACCGCATCGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339593    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020048.3-1601s21c1
Sequence:CCGGGCTGTTAATCTACAAAGTGTACTCGAGTACACTTTGTAGATTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020048.3-266s21c1
Sequence:CCGGGCTGATGTACGTGATGCATAACTCGAGTTATGCATCACGTACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)