EMAIL THIS PAGE TO A FRIEND

MED21

mediator complex subunit 21

99 Gene Product Result for
Synonyms: SRB7 SURB7 hSrb7
UniProtKB ID: Q13503, B2R4I3, Q6IB05, Q92811
Gene ID:
Human(9412) Summary: This gene encodes a member of the mediator complex subunit 21 family. The encoded protein interacts with the human RNA polymerase II holoenzyme and is involved in transcriptional regulation of RNA polymerase II transcribed genes. A pseudogene of this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(108098) mediator complex subunit 21
Rat(312849) mediator complex subunit 21
domestic guinea pig(100718031) mediator complex subunit 21
naked mole-rat(101713216) mediator complex subunit 21
sheep(101112043) mediator complex subunit 21
Zebrafish(406732) mediator complex subunit 21
cow(539496) mediator complex subunit 21
Horse(100069077) mediator complex subunit 21
domestic cat(101081644) mediator complex subunit 21
dog(477664) mediator complex subunit 21
chicken(418216) mediator complex subunit 21
Thale Cress(825815) mediator of RNA polymerase II transcription subunit 21
fruit fly(3354977) Mediator complex subunit 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017177 Anti-MED21 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV37735 Anti-MED21 antibody produced in rabbit affinity isolated antibody guinea pig, canine, bovine, zebrafish, rat, mouse, horse, human
western blot pricing
SAB4503634 Anti-MED21 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry pricing
SAB2106375 Anti-MED21 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human
ELISA, western blot pricing
SAB1411811 ANTI-SURB7 antibody produced in mouse clone 2D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411880 ANTI-SURB7 antibody produced in mouse clone 4B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1411882 ANTI-SURB7 antibody produced in mouse clone 6B6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
WH0009412M4 Monoclonal Anti-SURB7 antibody produced in mouse clone 5A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404715 Monoclonal Anti-SURB7 antibody produced in mouse clone 3E9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025315 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025315 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025315 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004264 Rosetta Predictions human pricing
NM_001107895 Rosetta Predictions rat pricing
NM_025315 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165494 predicted 617
2 SASI_Hs01_00165496 predicted 472
3 SASI_Hs01_00165497 predicted 360
4 SASI_Hs01_00165498 predicted 508
5 SASI_Hs01_00165499 predicted 295
6 SASI_Hs01_00165500 predicted 420
7 SASI_Hs01_00165501 predicted 534
8 SASI_Hs01_00165503 predicted 750
9 SASI_Hs02_00337228 predicted 555
10 SASI_Hs02_00337229 predicted 204
11 SASI_Hs01_00165495 predicted 545
12 SASI_Hs01_00165502 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233335 predicted 477
2 SASI_Rn02_00233336 predicted 60
3 SASI_Rn02_00233337 predicted 37
4 SASI_Rn02_00233338 predicted 332
5 SASI_Rn02_00233339 predicted 300
6 SASI_Rn02_00233340 predicted 137
7 SASI_Rn02_00233341 predicted 87
8 SASI_Rn02_00233342 predicted 509
9 SASI_Rn02_00233343 predicted 186
10 SASI_Rn02_00233344 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025315 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184976 predicted 341
2 SASI_Mm01_00184977 predicted 276
3 SASI_Mm01_00184978 predicted 285
4 SASI_Mm01_00184979 predicted 336
5 SASI_Mm01_00184981 predicted 280
6 SASI_Mm02_00327951 predicted 255
7 SASI_Mm01_00184982 predicted 293
8 SASI_Mm01_00184983 predicted 330
9 SASI_Mm01_00184984 predicted 328
10 SASI_Mm01_00184985 predicted 346
11 SASI_Mm01_00184980 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004264
VALIDATED
MED21 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-87s21c1
Sequence:CCGGTTGTAATGCCATTGGAGTATTCTCGAGAATACTCCAATGGCATTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004264.3-284s21c1
Sequence:CCGGTACAGGCTGCTAGCTTGTATACTCGAGTATACAAGCTAGCAGCCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-172s21c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-143s21c1
Sequence:CCGGTTCAGACAGCAATTAACAAAGCTCGAGCTTTGTTAATTGCTGTCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004264.3-659s21c1
Sequence:CCGGTAAAGCATCATACCATCATTTCTCGAGAAATGATGGTATGATGCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-172s1c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-292s1c1
Sequence:CCGGGCTAGCTTGTATAAGCTAGAACTCGAGTTCTAGCTTATACAAGCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-444s1c1
Sequence:CCGGCCAGTCTCTTCCAGACTCATACTCGAGTATGAGTCTGGAAGAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-95s1c1
Sequence:CCGGCCATTGGAGTATTGCAGCAATCTCGAGATTGCTGCAATACTCCAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004264.2-1327s1c1
Sequence:CCGGCCTCAGTTTATTATTGCCAAACTCGAGTTTGGCAATAATAAACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004264
VALIDATED
MED21 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-87s21c1
Sequence:CCGGTTGTAATGCCATTGGAGTATTCTCGAGAATACTCCAATGGCATTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004264.3-284s21c1
Sequence:CCGGTACAGGCTGCTAGCTTGTATACTCGAGTATACAAGCTAGCAGCCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-172s21c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-143s21c1
Sequence:CCGGTTCAGACAGCAATTAACAAAGCTCGAGCTTTGTTAATTGCTGTCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004264.3-659s21c1
Sequence:CCGGTAAAGCATCATACCATCATTTCTCGAGAAATGATGGTATGATGCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-172s1c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-292s1c1
Sequence:CCGGGCTAGCTTGTATAAGCTAGAACTCGAGTTCTAGCTTATACAAGCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-444s1c1
Sequence:CCGGCCAGTCTCTTCCAGACTCATACTCGAGTATGAGTCTGGAAGAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-95s1c1
Sequence:CCGGCCATTGGAGTATTGCAGCAATCTCGAGATTGCTGCAATACTCCAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004264.2-1327s1c1
Sequence:CCGGCCTCAGTTTATTATTGCCAAACTCGAGTTTGGCAATAATAAACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004264
VALIDATED
MED21 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-87s21c1
Sequence:CCGGTTGTAATGCCATTGGAGTATTCTCGAGAATACTCCAATGGCATTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004264.3-284s21c1
Sequence:CCGGTACAGGCTGCTAGCTTGTATACTCGAGTATACAAGCTAGCAGCCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-172s21c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004264.3-143s21c1
Sequence:CCGGTTCAGACAGCAATTAACAAAGCTCGAGCTTTGTTAATTGCTGTCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004264.3-659s21c1
Sequence:CCGGTAAAGCATCATACCATCATTTCTCGAGAAATGATGGTATGATGCTTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-172s1c1
Sequence:CCGGGCTAACCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-292s1c1
Sequence:CCGGGCTAGCTTGTATAAGCTAGAACTCGAGTTCTAGCTTATACAAGCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-444s1c1
Sequence:CCGGCCAGTCTCTTCCAGACTCATACTCGAGTATGAGTCTGGAAGAGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004264.2-95s1c1
Sequence:CCGGCCATTGGAGTATTGCAGCAATCTCGAGATTGCTGCAATACTCCAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004264.2-1327s1c1
Sequence:CCGGCCTCAGTTTATTATTGCCAAACTCGAGTTTGGCAATAATAAACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025315
VALIDATED
MED21 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 21
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-447s21c1
Sequence:CCGGCACTCTCTCCCAGACTCATAGCTCGAGCTATGAGTCTGGGAGAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-89s21c1
Sequence:CCGGTTGTAATGCCATTGGTGTATTCTCGAGAATACACCAATGGCATTACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-285s21c1
Sequence:CCGGTTACAGGCTGCTAGCTTATATCTCGAGATATAAGCTAGCAGCCTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-497s21c1
Sequence:CCGGGAACTGTTTGAATGGCATTAACTCGAGTTAATGCCATTCAAACAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-139s21c1
Sequence:CCGGGTAACATTCAAACAGCAATTACTCGAGTAATTGCTGTTTGAATGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-175s1c1
Sequence:CCGGGCCAATCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-542s1c1
Sequence:CCGGCCCTACCAACAGCTACAGAATCTCGAGATTCTGTAGCTGTTGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025315.1-295s1c1
Sequence:CCGGGCTAGCTTATATAAGCTAGAACTCGAGTTCTAGCTTATATAAGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-174s1c1
Sequence:CCGGAGCCAATCCTACAGAAGAGTACTCGAGTACTCTTCTGTAGGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-425s1c1
Sequence:CCGGAGACCAGAAGTGTTACCCATACTCGAGTATGGGTAACACTTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025315
VALIDATED
MED21 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 21
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-447s21c1
Sequence:CCGGCACTCTCTCCCAGACTCATAGCTCGAGCTATGAGTCTGGGAGAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-89s21c1
Sequence:CCGGTTGTAATGCCATTGGTGTATTCTCGAGAATACACCAATGGCATTACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-285s21c1
Sequence:CCGGTTACAGGCTGCTAGCTTATATCTCGAGATATAAGCTAGCAGCCTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-497s21c1
Sequence:CCGGGAACTGTTTGAATGGCATTAACTCGAGTTAATGCCATTCAAACAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-139s21c1
Sequence:CCGGGTAACATTCAAACAGCAATTACTCGAGTAATTGCTGTTTGAATGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-175s1c1
Sequence:CCGGGCCAATCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-542s1c1
Sequence:CCGGCCCTACCAACAGCTACAGAATCTCGAGATTCTGTAGCTGTTGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025315.1-295s1c1
Sequence:CCGGGCTAGCTTATATAAGCTAGAACTCGAGTTCTAGCTTATATAAGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-174s1c1
Sequence:CCGGAGCCAATCCTACAGAAGAGTACTCGAGTACTCTTCTGTAGGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-425s1c1
Sequence:CCGGAGACCAGAAGTGTTACCCATACTCGAGTATGGGTAACACTTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025315
VALIDATED
MED21 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 21
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-447s21c1
Sequence:CCGGCACTCTCTCCCAGACTCATAGCTCGAGCTATGAGTCTGGGAGAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-89s21c1
Sequence:CCGGTTGTAATGCCATTGGTGTATTCTCGAGAATACACCAATGGCATTACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-285s21c1
Sequence:CCGGTTACAGGCTGCTAGCTTATATCTCGAGATATAAGCTAGCAGCCTGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-497s21c1
Sequence:CCGGGAACTGTTTGAATGGCATTAACTCGAGTTAATGCCATTCAAACAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025315.3-139s21c1
Sequence:CCGGGTAACATTCAAACAGCAATTACTCGAGTAATTGCTGTTTGAATGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-175s1c1
Sequence:CCGGGCCAATCCTACAGAAGAGTATCTCGAGATACTCTTCTGTAGGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-542s1c1
Sequence:CCGGCCCTACCAACAGCTACAGAATCTCGAGATTCTGTAGCTGTTGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025315.1-295s1c1
Sequence:CCGGGCTAGCTTATATAAGCTAGAACTCGAGTTCTAGCTTATATAAGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-174s1c1
Sequence:CCGGAGCCAATCCTACAGAAGAGTACTCGAGTACTCTTCTGTAGGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025315.1-425s1c1
Sequence:CCGGAGACCAGAAGTGTTACCCATACTCGAGTATGGGTAACACTTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)