EMAIL THIS PAGE TO A FRIEND

MED22

mediator complex subunit 22

95 Gene Product Result for
Synonyms: MED24 SURF5 surf-5
UniProtKB ID: Q15528, B3KW83, B3KWX4, O76072, Q5T8U0
Gene ID:
Human(6837) Summary: This gene encodes a protein component of the mediator complex, which functions in the regulation of transcription by bridging interactions between gene-specific regulatory factors, RNA polymerase II, and general transcription factors. Alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2013]
Mouse(20933) mediator complex subunit 22
Rat(499762) mediator complex subunit 22
Zebrafish(415234) mediator complex subunit 22
fruit fly(31038) Mediator complex subunit 22
chicken(417159) mediator complex subunit 22
cow(613736) mediator complex subunit 22
domestic cat(101084750) mediator complex subunit 22
dog(480680) mediator complex subunit 22
sheep(101110402) mediator complex subunit 22
naked mole-rat(101709958) mediator complex subunit 22
domestic guinea pig(100716382) mediator complex subunit 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133640 Rosetta Predictions human pricing
NM_181491 Rosetta Predictions human pricing
NM_001077679 Rosetta Predictions rat pricing
NM_001033908 Rosetta Predictions mouse pricing
NM_011513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244504 predicted 886
2 SASI_Hs01_00244505 predicted 843
3 SASI_Hs01_00244507 predicted 332
4 SASI_Hs01_00244508 predicted 1053
5 SASI_Hs01_00244509 predicted 1089
6 SASI_Hs01_00244510 predicted 391
7 SASI_Hs01_00244512 predicted 906
8 SASI_Hs01_00244513 predicted 1089
9 SASI_Hs02_00363281 predicted 1202
10 SASI_Hs02_00363282 predicted 337
11 SASI_Hs01_00244506 predicted 1007
12 SASI_Hs01_00244511 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107210 predicted 335
2 SASI_Hs01_00107211 predicted 389
3 SASI_Hs02_00370109 predicted 332
4 SASI_Hs01_00107212 predicted 1088
5 SASI_Hs01_00107213 predicted 797
6 SASI_Hs01_00107215 predicted 841
7 SASI_Hs01_00107216 predicted 992
8 SASI_Hs01_00107217 predicted 874
9 SASI_Hs01_00107218 predicted 868
10 SASI_Hs01_00107219 predicted 807
11 SASI_Hs01_00107214 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207909 predicted 1024
2 SASI_Rn02_00207910 predicted 909
3 SASI_Rn02_00207911 predicted 373
4 SASI_Rn02_00207912 predicted 522
5 SASI_Rn02_00207913 predicted 954
6 SASI_Rn02_00207914 predicted 456
7 SASI_Rn02_00207915 predicted 228
8 SASI_Rn02_00207916 predicted 1050
9 SASI_Rn02_00207917 predicted 671
10 SASI_Rn02_00207918 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141335 predicted 1075
2 SASI_Mm01_00141336 predicted 1147
3 SASI_Mm02_00289035 predicted 667
4 SASI_Mm02_00289036 predicted 742
5 SASI_Mm01_00141338 predicted 1056
6 SASI_Mm01_00141339 predicted 383
7 SASI_Mm02_00289037 predicted 704
8 SASI_Mm01_00141340 predicted 406
9 SASI_Mm02_00289038 predicted 1116
10 SASI_Mm02_00289039 predicted 628
11 SASI_Mm01_00141334 predicted 871
12 SASI_Mm01_00141337 predicted 1122
13 SASI_Mm01_00141341 predicted 857
14 SASI_Mm01_00141342 predicted 349
15 SASI_Mm01_00141343 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109506 predicted 386
2 SASI_Mm01_00109510 predicted 317
3 SASI_Mm01_00109507 predicted 405
4 SASI_Mm01_00109508 predicted 340
5 SASI_Mm01_00109509 predicted 369
6 SASI_Mm01_00109511 predicted 975
7 SASI_Mm01_00109512 predicted 927
8 SASI_Mm01_00109513 predicted 548
9 SASI_Mm01_00109514 predicted 1039
10 SASI_Mm01_00109515 predicted 438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011513
VALIDATED
MED22 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 22
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-629s21c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011513.1-304s1c1
Sequence:CCGGCAAGTCCATCATGGACAACTTCTCGAGAAGTTGTCCATGATGGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-395s1c1
Sequence:CCGGGACAATTATGAGATGCACGTTCTCGAGAACGTGCATCTCATAATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-314s21c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-628s1c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-313s1c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-625s1c1
Sequence:CCGGGTACTACTCGTCCAGGTACAACTCGAGTTGTACCTGGACGAGTAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-277s21c1
Sequence:CCGGCATACAACAAGCGGCTCAAAGCTCGAGCTTTGAGCCGCTTGTTGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-919s21c1
Sequence:CCGGCTCTGTCTTACTGCTTTAAATCTCGAGATTTAAAGCAGTAAGACAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-463s21c1
Sequence:CCGGTATCCGATCTCAAGCAGTTTCCTCGAGGAAACTGCTTGAGATCGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011513
VALIDATED
MED22 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 22
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-629s21c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011513.1-304s1c1
Sequence:CCGGCAAGTCCATCATGGACAACTTCTCGAGAAGTTGTCCATGATGGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-395s1c1
Sequence:CCGGGACAATTATGAGATGCACGTTCTCGAGAACGTGCATCTCATAATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-314s21c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-628s1c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-313s1c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-625s1c1
Sequence:CCGGGTACTACTCGTCCAGGTACAACTCGAGTTGTACCTGGACGAGTAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-277s21c1
Sequence:CCGGCATACAACAAGCGGCTCAAAGCTCGAGCTTTGAGCCGCTTGTTGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-919s21c1
Sequence:CCGGCTCTGTCTTACTGCTTTAAATCTCGAGATTTAAAGCAGTAAGACAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-463s21c1
Sequence:CCGGTATCCGATCTCAAGCAGTTTCCTCGAGGAAACTGCTTGAGATCGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011513
VALIDATED
MED22 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 22
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-629s21c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011513.1-304s1c1
Sequence:CCGGCAAGTCCATCATGGACAACTTCTCGAGAAGTTGTCCATGATGGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-395s1c1
Sequence:CCGGGACAATTATGAGATGCACGTTCTCGAGAACGTGCATCTCATAATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-314s21c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-628s1c1
Sequence:CCGGCTACTCGTCCAGGTACAAATACTCGAGTATTTGTACCTGGACGAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-313s1c1
Sequence:CCGGCATGGACAACTTCACCGAGATCTCGAGATCTCGGTGAAGTTGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011513.1-625s1c1
Sequence:CCGGGTACTACTCGTCCAGGTACAACTCGAGTTGTACCTGGACGAGTAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-277s21c1
Sequence:CCGGCATACAACAAGCGGCTCAAAGCTCGAGCTTTGAGCCGCTTGTTGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276947    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-919s21c1
Sequence:CCGGCTCTGTCTTACTGCTTTAAATCTCGAGATTTAAAGCAGTAAGACAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011513.2-463s21c1
Sequence:CCGGTATCCGATCTCAAGCAGTTTCCTCGAGGAAACTGCTTGAGATCGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133640
VALIDATED
MED22 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 22
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1001s1c1
Sequence:CCGGCAGGACAGTAGGGAAACAGTTCTCGAGAACTGTTTCCCTACTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-309s1c1
Sequence:CCGGCATTAAGTCCATCATGGACAACTCGAGTTGTCCATGATGGACTTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-597s1c1
Sequence:CCGGCGAGATCTCCATTGACCTCTACTCGAGTAGAGGTCAATGGAGATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-486s1c1
Sequence:CCGGGTTCCTGATCCTCAATGACTTCTCGAGAAGTCATTGAGGATCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-306s1c1
Sequence:CCGGCGACATTAAGTCCATCATGGACTCGAGTCCATGATGGACTTAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-400s1c1
Sequence:CCGGCAGGACAATTACGAGATGCATCTCGAGATGCATCTCGTAATTGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-339s1c1
Sequence:CCGGGATCATCAAGACCGCCAAGATCTCGAGATCTTGGCGGTCTTGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1033s1c1
Sequence:CCGGCATTTCCGAATAGCCCATCATCTCGAGATGATGGGCTATTCGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-649s1c1
Sequence:CCGGTCAAGCCTTTGCGAAGCTAATCTCGAGATTAGCTTCGCAAAGGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-282s1c1
Sequence:CCGGGTCCTACAACAAGCGGCTGAACTCGAGTTCAGCCGCTTGTTGTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133640
VALIDATED
MED22 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 22
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1001s1c1
Sequence:CCGGCAGGACAGTAGGGAAACAGTTCTCGAGAACTGTTTCCCTACTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-309s1c1
Sequence:CCGGCATTAAGTCCATCATGGACAACTCGAGTTGTCCATGATGGACTTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-597s1c1
Sequence:CCGGCGAGATCTCCATTGACCTCTACTCGAGTAGAGGTCAATGGAGATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-486s1c1
Sequence:CCGGGTTCCTGATCCTCAATGACTTCTCGAGAAGTCATTGAGGATCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-306s1c1
Sequence:CCGGCGACATTAAGTCCATCATGGACTCGAGTCCATGATGGACTTAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-400s1c1
Sequence:CCGGCAGGACAATTACGAGATGCATCTCGAGATGCATCTCGTAATTGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-339s1c1
Sequence:CCGGGATCATCAAGACCGCCAAGATCTCGAGATCTTGGCGGTCTTGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1033s1c1
Sequence:CCGGCATTTCCGAATAGCCCATCATCTCGAGATGATGGGCTATTCGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-649s1c1
Sequence:CCGGTCAAGCCTTTGCGAAGCTAATCTCGAGATTAGCTTCGCAAAGGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-282s1c1
Sequence:CCGGGTCCTACAACAAGCGGCTGAACTCGAGTTCAGCCGCTTGTTGTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133640
VALIDATED
MED22 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 22
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1001s1c1
Sequence:CCGGCAGGACAGTAGGGAAACAGTTCTCGAGAACTGTTTCCCTACTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-309s1c1
Sequence:CCGGCATTAAGTCCATCATGGACAACTCGAGTTGTCCATGATGGACTTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-597s1c1
Sequence:CCGGCGAGATCTCCATTGACCTCTACTCGAGTAGAGGTCAATGGAGATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-486s1c1
Sequence:CCGGGTTCCTGATCCTCAATGACTTCTCGAGAAGTCATTGAGGATCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133640.3-306s1c1
Sequence:CCGGCGACATTAAGTCCATCATGGACTCGAGTCCATGATGGACTTAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-400s1c1
Sequence:CCGGCAGGACAATTACGAGATGCATCTCGAGATGCATCTCGTAATTGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-339s1c1
Sequence:CCGGGATCATCAAGACCGCCAAGATCTCGAGATCTTGGCGGTCTTGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133640.3-1033s1c1
Sequence:CCGGCATTTCCGAATAGCCCATCATCTCGAGATGATGGGCTATTCGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-649s1c1
Sequence:CCGGTCAAGCCTTTGCGAAGCTAATCTCGAGATTAGCTTCGCAAAGGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_133640.3-282s1c1
Sequence:CCGGGTCCTACAACAAGCGGCTGAACTCGAGTTCAGCCGCTTGTTGTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)