EMAIL THIS PAGE TO A FRIEND

MED23

mediator complex subunit 23

95 Gene Product Result for
Synonyms: ARC130 CRSP130 CRSP133 CRSP3 DRIP130 MRT18 SUR-2 SUR2
Gene ID:
Human(9439) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
Mouse(70208) mediator complex subunit 23
Rat(309565) mediator complex subunit 23
Zebrafish(445483) mediator complex subunit 23
fruit fly(37639) Mediator complex subunit 23
chicken(426927) mediator complex subunit 23
dog(474822) mediator complex subunit 23
domestic cat(101093861) mediator complex subunit 23
cow(513610) mediator complex subunit 23
Horse(100067556) mediator complex subunit 23
domestic guinea pig(100727487) mediator complex subunit 23
naked mole-rat(101704535) mediator complex subunit 23
Domestic Rabbit(100342894) mediator complex subunit 23
sheep(101121942) mediator complex subunit 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004830 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004830 Rosetta Predictions human pricing
NM_015979 Rosetta Predictions human pricing
XM_001053195 Rosetta Predictions rat pricing
XM_001053256 Rosetta Predictions rat pricing
XM_001057683 Rosetta Predictions rat pricing
XM_220093 Rosetta Predictions rat pricing
NM_027347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152514 predicted 782
2 SASI_Hs01_00152515 predicted 3175
3 SASI_Hs02_00338401 predicted 2213
4 SASI_Hs01_00152517 predicted 3412
5 SASI_Hs01_00152518 predicted 3363
6 SASI_Hs01_00152519 predicted 3380
7 SASI_Hs01_00152520 predicted 3186
8 SASI_Hs01_00152521 predicted 1797
9 SASI_Hs01_00152522 predicted 3701
10 SASI_Hs02_00338402 predicted 3013
11 SASI_Hs01_00152513 predicted 3771
12 SASI_Hs01_00152516 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095489 predicted 789
2 SASI_Hs01_00095490 predicted 3190
3 SASI_Hs02_00348650 predicted 2228
4 SASI_Hs01_00095492 predicted 3427
5 SASI_Hs01_00095493 predicted 3386
6 SASI_Hs01_00095494 predicted 3390
7 SASI_Hs01_00095495 predicted 3205
8 SASI_Hs01_00095496 predicted 1815
9 SASI_Hs01_00095497 predicted 3721
10 SASI_Hs02_00348651 predicted 3035
11 SASI_Hs01_00095488 predicted 3790
12 SASI_Hs01_00095491 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271612 predicted 1711
2 SASI_Rn02_00271613 predicted 586
3 SASI_Rn02_00271614 predicted 3596
4 SASI_Rn02_00271615 predicted 930
5 SASI_Rn02_00271616 predicted 3507
6 SASI_Rn02_00271617 predicted 1686
7 SASI_Rn02_00271618 predicted 3998
8 SASI_Rn02_00271619 predicted 697
9 SASI_Rn02_00271620 predicted 1923
10 SASI_Rn02_00271621 predicted 2702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271726 predicted 1713
2 SASI_Rn02_00271727 predicted 588
3 SASI_Rn02_00271728 predicted 3607
4 SASI_Rn02_00271729 predicted 935
5 SASI_Rn02_00271730 predicted 3513
6 SASI_Rn02_00271731 predicted 1687
7 SASI_Rn02_00271732 predicted 4008
8 SASI_Rn02_00271733 predicted 703
9 SASI_Rn02_00271734 predicted 1927
10 SASI_Rn02_00271735 predicted 2711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287179 predicted 1709
2 SASI_Rn02_00287180 predicted 588
3 SASI_Rn02_00287181 predicted 3591
4 SASI_Rn02_00287182 predicted 931
5 SASI_Rn02_00287183 predicted 3508
6 SASI_Rn02_00287184 predicted 1690
7 SASI_Rn02_00287185 predicted 4005
8 SASI_Rn02_00287186 predicted 700
9 SASI_Rn02_00287187 predicted 1923
10 SASI_Rn02_00287188 predicted 2569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379035 predicted 1711
2 SASI_Rn02_00379036 predicted 591
3 SASI_Rn02_00379037 predicted 3598
4 SASI_Rn02_00379038 predicted 934
5 SASI_Rn02_00379039 predicted 3513
6 SASI_Rn02_00379040 predicted 1685
7 SASI_Rn02_00379041 predicted 4013
8 SASI_Rn02_00379042 predicted 705
9 SASI_Rn02_00379043 predicted 1921
10 SASI_Rn02_00379044 predicted 2707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332005 predicted 3057
2 SASI_Mm01_00074850 predicted 1680
3 SASI_Mm01_00074851 predicted 583
4 SASI_Mm01_00074852 predicted 3579
5 SASI_Mm01_00074853 predicted 4024
6 SASI_Mm01_00074854 predicted 4038
7 SASI_Mm01_00074855 predicted 3491
8 SASI_Mm01_00074856 predicted 1782
9 SASI_Mm01_00074857 predicted 4199
10 SASI_Mm01_00074858 predicted 3673
11 SASI_Mm01_00074849 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027347
VALIDATED
MED23 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 23
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-876s21c1
Sequence:CCGGATGTACTGGAGCAACCTTATTCTCGAGAATAAGGTTGCTCCAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4244s1c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-2833s1c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-564s1c1
Sequence:CCGGCTTATATCTTAGAACGAAATGCTCGAGCATTTCGTTCTAAGATATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-1751s1c1
Sequence:CCGGGTGGAAACTTACAGCCGTTTACTCGAGTAAACGGCTGTAAGTTTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-465s1c1
Sequence:CCGGGAGACCTTCTCAAAGCGATTTCTCGAGAAATCGCTTTGAGAAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-2833s21c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-767s21c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-4244s21c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-767s1c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-407s1c1
Sequence:CCGGGCCTTAACATTTAAGCTGGTTCTCGAGAACCAGCTTAAATGTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4243s1c1
Sequence:CCGGGCCACCATGTTCAGATTGGTTCTCGAGAACCAATCTGAACATGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027347
VALIDATED
MED23 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 23
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-876s21c1
Sequence:CCGGATGTACTGGAGCAACCTTATTCTCGAGAATAAGGTTGCTCCAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4244s1c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-2833s1c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-564s1c1
Sequence:CCGGCTTATATCTTAGAACGAAATGCTCGAGCATTTCGTTCTAAGATATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-1751s1c1
Sequence:CCGGGTGGAAACTTACAGCCGTTTACTCGAGTAAACGGCTGTAAGTTTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-465s1c1
Sequence:CCGGGAGACCTTCTCAAAGCGATTTCTCGAGAAATCGCTTTGAGAAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-2833s21c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-767s21c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-4244s21c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-767s1c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-407s1c1
Sequence:CCGGGCCTTAACATTTAAGCTGGTTCTCGAGAACCAGCTTAAATGTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4243s1c1
Sequence:CCGGGCCACCATGTTCAGATTGGTTCTCGAGAACCAATCTGAACATGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027347
VALIDATED
MED23 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 23
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-876s21c1
Sequence:CCGGATGTACTGGAGCAACCTTATTCTCGAGAATAAGGTTGCTCCAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178858    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4244s1c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-2833s1c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-564s1c1
Sequence:CCGGCTTATATCTTAGAACGAAATGCTCGAGCATTTCGTTCTAAGATATAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-1751s1c1
Sequence:CCGGGTGGAAACTTACAGCCGTTTACTCGAGTAAACGGCTGTAAGTTTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-465s1c1
Sequence:CCGGGAGACCTTCTCAAAGCGATTTCTCGAGAAATCGCTTTGAGAAGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-2833s21c1
Sequence:CCGGCCACAAGAAATATCCCGAGAACTCGAGTTCTCGGGATATTTCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-767s21c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027347.2-4244s21c1
Sequence:CCGGCCACCATGTTCAGATTGGTTTCTCGAGAAACCAATCTGAACATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-767s1c1
Sequence:CCGGGCCATCTGTAACTCATGGAAACTCGAGTTTCCATGAGTTACAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027347.2-407s1c1
Sequence:CCGGGCCTTAACATTTAAGCTGGTTCTCGAGAACCAGCTTAAATGTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196182    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027347.2-4243s1c1
Sequence:CCGGGCCACCATGTTCAGATTGGTTCTCGAGAACCAATCTGAACATGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004830
VALIDATED
MED23 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1875s21c1
Sequence:GTACCGGCAGTCGTTTATTGGTCTATATCTCGAGATATAGACCAATAAACGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3190s21c1
Sequence:CCGGTATAACACTCTGCACTATTATCTCGAGATAATAGTGCAGAGTGTTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1715s21c1
Sequence:CCGGGTATGGCTTCAGGATCTATTACTCGAGTAATAGATCCTGAAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-697s1c1
Sequence:CCGGGCCTGCTTATTACCAGCCTATCTCGAGATAGGCTGGTAATAAGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004830.2-2162s1c1
Sequence:CCGGCGCAGTTTACACGCTTCCTTACTCGAGTAAGGAAGCGTGTAAACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-999s1c1
Sequence:CCGGGCAGCCTTATTCCAGGGATATCTCGAGATATCCCTGGAATAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-3228s1c1
Sequence:CCGGCCGCGCATTTCTCAAACGAAACTCGAGTTTCGTTTGAGAAATGCGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-2810s1c1
Sequence:CCGGCCCAGGTTTGTTATTTCATAACTCGAGTTATGAAATAACAAACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004830.2-4426s21c1
Sequence:CCGGGAATCTGTTGACACCTTATAACTCGAGTTATAAGGTGTCAACAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3139s21c1
Sequence:GTACCGGGATCATCTAGGAGGCTTATATCTCGAGATATAAGCCTCCTAGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004830
VALIDATED
MED23 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1875s21c1
Sequence:GTACCGGCAGTCGTTTATTGGTCTATATCTCGAGATATAGACCAATAAACGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3190s21c1
Sequence:CCGGTATAACACTCTGCACTATTATCTCGAGATAATAGTGCAGAGTGTTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1715s21c1
Sequence:CCGGGTATGGCTTCAGGATCTATTACTCGAGTAATAGATCCTGAAGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-697s1c1
Sequence:CCGGGCCTGCTTATTACCAGCCTATCTCGAGATAGGCTGGTAATAAGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004830.2-2162s1c1
Sequence:CCGGCGCAGTTTACACGCTTCCTTACTCGAGTAAGGAAGCGTGTAAACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-999s1c1
Sequence:CCGGGCAGCCTTATTCCAGGGATATCTCGAGATATCCCTGGAATAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-3228s1c1
Sequence:CCGGCCGCGCATTTCTCAAACGAAACTCGAGTTTCGTTTGAGAAATGCGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-2810s1c1
Sequence:CCGGCCCAGGTTTGTTATTTCATAACTCGAGTTATGAAATAACAAACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004830.2-4426s21c1
Sequence:CCGGGAATCTGTTGACACCTTATAACTCGAGTTATAAGGTGTCAACAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3139s21c1
Sequence:GTACCGGGATCATCTAGGAGGCTTATATCTCGAGATATAAGCCTCCTAGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004830
VALIDATED
MED23 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1875s21c1
Sequence:GTACCGGCAGTCGTTTATTGGTCTATATCTCGAGATATAGACCAATAAACGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3190s21c1
Sequence:CCGGTATAACACTCTGCACTATTATCTCGAGATAATAGTGCAGAGTGTTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-1715s21c1
Sequence:CCGGGTATGGCTTCAGGATCTATTACTCGAGTAATAGATCCTGAAGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-697s1c1
Sequence:CCGGGCCTGCTTATTACCAGCCTATCTCGAGATAGGCTGGTAATAAGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004830.2-2162s1c1
Sequence:CCGGCGCAGTTTACACGCTTCCTTACTCGAGTAAGGAAGCGTGTAAACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-999s1c1
Sequence:CCGGGCAGCCTTATTCCAGGGATATCTCGAGATATCCCTGGAATAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-3228s1c1
Sequence:CCGGCCGCGCATTTCTCAAACGAAACTCGAGTTTCGTTTGAGAAATGCGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004830.2-2810s1c1
Sequence:CCGGCCCAGGTTTGTTATTTCATAACTCGAGTTATGAAATAACAAACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004830.2-4426s21c1
Sequence:CCGGGAATCTGTTGACACCTTATAACTCGAGTTATAAGGTGTCAACAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004830.2-3139s21c1
Sequence:GTACCGGGATCATCTAGGAGGCTTATATCTCGAGATATAAGCCTCCTAGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)