EMAIL THIS PAGE TO A FRIEND

MED24

mediator complex subunit 24

62 Gene Product Result for
Synonyms: ARC100 CRSP100 CRSP4 DRIP100 THRAP4 TRAP100
UniProtKB ID: O75448, A8K4S5, B3KMR9, Q14143, Q9NNY5
Gene ID:
Human(9862) Summary: This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(23989) mediator complex subunit 24
Rat(619436) mediator complex subunit 24
sheep(101106089) mediator complex subunit 24
Domestic Rabbit(100357423) mediator complex subunit 24
naked mole-rat(101697186) mediator complex subunit 24
domestic guinea pig(100725996) mediator complex subunit 24
Zebrafish(323621) mediator complex subunit 24
fruit fly(38914) Mediator complex subunit 24
cow(504613) mediator complex subunit 24
Horse(100054553) mediator complex subunit 24
domestic cat(101094551) mediator complex subunit 24
dog(480529) mediator complex subunit 24
chicken(426134) mediator complex subunit 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069201 MISSION® esiRNA esiRNA human THRAP4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079518 Rosetta Predictions human pricing
NM_014815 Rosetta Predictions human pricing
NM_001034079 Rosetta Predictions rat pricing
NM_011869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313410 predicted 1365
2 SASI_Hs02_00313411 predicted 1049
3 SASI_Hs02_00313412 predicted 1687
4 SASI_Hs02_00313413 predicted 2805
5 SASI_Hs02_00313414 predicted 1488
6 SASI_Hs02_00313415 predicted 2521
7 SASI_Hs02_00313416 predicted 1674
8 SASI_Hs02_00313417 predicted 1968
9 SASI_Hs02_00313418 predicted 1905
10 SASI_Hs02_00313419 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125066 predicted 1390
2 SASI_Hs01_00125067 predicted 1070
3 SASI_Hs01_00125068 predicted 1702
4 SASI_Hs01_00125069 predicted 2823
5 SASI_Hs02_00346346 predicted 1497
6 SASI_Hs01_00125070 predicted 2542
7 SASI_Hs02_00346347 predicted 1692
8 SASI_Hs01_00125071 predicted 1985
9 SASI_Hs01_00125072 predicted 1916
10 SASI_Hs01_00125073 predicted 904
11 SASI_Hs01_00125074 predicted 470
12 SASI_Hs01_00125075 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055923 predicted 1478
2 SASI_Rn01_00055924 predicted 1404
3 SASI_Rn01_00055925 predicted 2597
4 SASI_Rn01_00055926 predicted 284
5 SASI_Rn01_00055927 predicted 262
6 SASI_Rn01_00055928 predicted 2848
7 SASI_Rn01_00055929 predicted 1152
8 SASI_Rn01_00055930 predicted 2067
9 SASI_Rn01_00055931 predicted 1758
10 SASI_Rn01_00055932 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026768 predicted 2960
2 SASI_Mm01_00026770 predicted 1805
3 SASI_Mm01_00026771 predicted 2359
4 SASI_Mm01_00026772 predicted 334
5 SASI_Mm02_00321649 predicted 3186
6 SASI_Mm01_00026774 predicted 2887
7 SASI_Mm01_00026775 predicted 2114
8 SASI_Mm02_00321650 predicted 1826
9 SASI_Mm02_00321651 predicted 2553
10 SASI_Mm02_00321652 predicted 871
11 SASI_Mm01_00026767 predicted 703
12 SASI_Mm01_00026769 predicted 1296
13 SASI_Mm01_00026773 predicted 2726
14 SASI_Mm01_00026776 predicted 2774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014815
MED24 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 24
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1406s1c1
Sequence:CCGGCGTCAACAACCTTATGGCTAACTCGAGTTAGCCATAAGGTTGTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1520s1c1
Sequence:CCGGCACTGTCACAAACATCCTCAACTCGAGTTGAGGATGTTTGTGACAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-338s1c1
Sequence:CCGGCCAATGGGCAATCAACATGAACTCGAGTTCATGTTGATTGCCCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-2783s1c1
Sequence:CCGGCCGCGAAGACATTGAGGATTACTCGAGTAATCCTCAATGTCTTCGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1980s1c1
Sequence:CCGGCTAGTGCAGATGAAGTGGCATCTCGAGATGCCACTTCATCTGCACTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2543s21c1
Sequence:GTACCGGTTCTGCAACAACCTGATTAAGCTCGAGCTTAATCAGGTTGTTGCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2823s21c1
Sequence:CCGGGCGAAGACATTGAGGATTATACTCGAGTATAATCCTCAATGTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014815.3-3444s21c1
Sequence:CCGGCAGGATGTCTCCCGGTTTCTTCTCGAGAAGAAACCGGGAGACATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2885s21c1
Sequence:CCGGATGCGACTGCTGAGCTCTAATCTCGAGATTAGAGCTCAGCAGTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-1439s21c1
Sequence:CCGGGCCAGCGTCAACAACCTTATGCTCGAGCATAAGGTTGTTGACGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014815
MED24 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 24
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1406s1c1
Sequence:CCGGCGTCAACAACCTTATGGCTAACTCGAGTTAGCCATAAGGTTGTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1520s1c1
Sequence:CCGGCACTGTCACAAACATCCTCAACTCGAGTTGAGGATGTTTGTGACAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-338s1c1
Sequence:CCGGCCAATGGGCAATCAACATGAACTCGAGTTCATGTTGATTGCCCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-2783s1c1
Sequence:CCGGCCGCGAAGACATTGAGGATTACTCGAGTAATCCTCAATGTCTTCGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1980s1c1
Sequence:CCGGCTAGTGCAGATGAAGTGGCATCTCGAGATGCCACTTCATCTGCACTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2543s21c1
Sequence:GTACCGGTTCTGCAACAACCTGATTAAGCTCGAGCTTAATCAGGTTGTTGCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2823s21c1
Sequence:CCGGGCGAAGACATTGAGGATTATACTCGAGTATAATCCTCAATGTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014815.3-3444s21c1
Sequence:CCGGCAGGATGTCTCCCGGTTTCTTCTCGAGAAGAAACCGGGAGACATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2885s21c1
Sequence:CCGGATGCGACTGCTGAGCTCTAATCTCGAGATTAGAGCTCAGCAGTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-1439s21c1
Sequence:CCGGGCCAGCGTCAACAACCTTATGCTCGAGCATAAGGTTGTTGACGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014815
MED24 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 24
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1406s1c1
Sequence:CCGGCGTCAACAACCTTATGGCTAACTCGAGTTAGCCATAAGGTTGTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1520s1c1
Sequence:CCGGCACTGTCACAAACATCCTCAACTCGAGTTGAGGATGTTTGTGACAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-338s1c1
Sequence:CCGGCCAATGGGCAATCAACATGAACTCGAGTTCATGTTGATTGCCCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-2783s1c1
Sequence:CCGGCCGCGAAGACATTGAGGATTACTCGAGTAATCCTCAATGTCTTCGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014815.2-1980s1c1
Sequence:CCGGCTAGTGCAGATGAAGTGGCATCTCGAGATGCCACTTCATCTGCACTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2543s21c1
Sequence:GTACCGGTTCTGCAACAACCTGATTAAGCTCGAGCTTAATCAGGTTGTTGCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2823s21c1
Sequence:CCGGGCGAAGACATTGAGGATTATACTCGAGTATAATCCTCAATGTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014815.3-3444s21c1
Sequence:CCGGCAGGATGTCTCCCGGTTTCTTCTCGAGAAGAAACCGGGAGACATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-2885s21c1
Sequence:CCGGATGCGACTGCTGAGCTCTAATCTCGAGATTAGAGCTCAGCAGTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014815.3-1439s21c1
Sequence:CCGGGCCAGCGTCAACAACCTTATGCTCGAGCATAAGGTTGTTGACGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011869
VALIDATED
MED24 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 24
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-2207s1c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-343s1c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-786s1c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-788s1c1
Sequence:CCGGCATAGAGCATTCTCTTCTAAACTCGAGTTTAGAAGAGAATGCTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-3260s1c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-2129s21c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-322s21c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-3182s21c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-708s21c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011869
VALIDATED
MED24 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 24
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-2207s1c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-343s1c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-786s1c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-788s1c1
Sequence:CCGGCATAGAGCATTCTCTTCTAAACTCGAGTTTAGAAGAGAATGCTCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-3260s1c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-2129s21c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-322s21c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-3182s21c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-708s21c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011869
VALIDATED
MED24 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 24
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-2207s1c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-343s1c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-786s1c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-788s1c1
Sequence:CCGGCATAGAGCATTCTCTTCTAAACTCGAGTTTAGAAGAGAATGCTCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011869.1-3260s1c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-2129s21c1
Sequence:CCGGGAACTCAATCTTGGAACACATCTCGAGATGTGTTCCAAGATTGAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-322s21c1
Sequence:CCGGCGTACCTGAAGTACGCCATTACTCGAGTAATGGCGTACTTCAGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-3182s21c1
Sequence:CCGGCCCTGACTCATCATGGCCCTACTCGAGTAGGGCCATGATGAGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011869.2-708s21c1
Sequence:CCGGGCCATAGAGCATTCTCTTCTACTCGAGTAGAAGAGAATGCTCTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)