EMAIL THIS PAGE TO A FRIEND

MED25

mediator complex subunit 25

60 Gene Product Result for
Synonyms: ACID1 ARC92 CMT2B2 P78 PTOV2
Gene ID:
Human(81857) Summary: This gene encodes a component of the transcriptional coactivator complex termed the Mediator complex. This complex is required for transcription of most RNA polymerase II-dependent genes. The encoded protein plays a role in chromatin modification and in preinitiation complex assembly. Mutations in this gene are associated with Charcot-Marie-Tooth disease type 2B2. [provided by RefSeq, Apr 2010]
Mouse(75613) mediator of RNA polymerase II transcription, subunit 25 homolog (yeast)
Rat(292889) mediator complex subunit 25
Zebrafish(406793) mediator of RNA polymerase II transcription, subunit 25 homolog (yeast)
cow(533865) mediator complex subunit 25
domestic cat(101094064) mediator complex subunit 25
dog(484374) mediator complex subunit 25
fruit fly(42385) Mediator complex subunit 25
domestic guinea pig(100722878) mediator complex subunit 25
naked mole-rat(101714843) mediator complex subunit 25
sheep(101113696) mediator complex subunit 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030973 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030973 Rosetta Predictions human pricing
XM_001080653 Rosetta Predictions rat pricing
XM_214950 Rosetta Predictions rat pricing
NM_029365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358566 predicted 383
2 SASI_Hs01_00197308 predicted 1298
3 SASI_Hs01_00197309 predicted 1984
4 SASI_Hs01_00197311 predicted 1769
5 SASI_Hs01_00197312 predicted 1438
6 SASI_Hs01_00197313 predicted 407
7 SASI_Hs01_00197314 predicted 238
8 SASI_Hs02_00358567 predicted 1663
9 SASI_Hs02_00358568 predicted 548
10 SASI_Hs01_00197315 predicted 526
11 SASI_Hs01_00197310 predicted 1591
12 SASI_Hs01_00197316 predicted 1601
13 SASI_Hs01_00197317 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00368830 predicted 466
2 SASI_Rn02_00368831 predicted 657
3 SASI_Rn02_00368832 predicted 696
4 SASI_Rn02_00368833 predicted 2149
5 SASI_Rn02_00368834 predicted 1540
6 SASI_Rn02_00368835 predicted 1536
7 SASI_Rn02_00368836 predicted 685
8 SASI_Rn02_00368837 predicted 363
9 SASI_Rn02_00368838 predicted 880
10 SASI_Rn02_00368839 predicted 492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375697 predicted 460
2 SASI_Rn02_00375698 predicted 657
3 SASI_Rn02_00375699 predicted 696
4 SASI_Rn02_00375700 predicted 2154
5 SASI_Rn02_00375701 predicted 1540
6 SASI_Rn02_00375702 predicted 1531
7 SASI_Rn02_00375703 predicted 684
8 SASI_Rn02_00375704 predicted 359
9 SASI_Rn02_00375705 predicted 879
10 SASI_Rn02_00375706 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085004 predicted 614
2 SASI_Mm01_00085006 predicted 523
3 SASI_Mm02_00335232 predicted 1288
4 SASI_Mm01_00085008 predicted 250
5 SASI_Mm02_00335233 predicted 228
6 SASI_Mm01_00085009 predicted 470
7 SASI_Mm01_00085010 predicted 495
8 SASI_Mm01_00085011 predicted 382
9 SASI_Mm01_00085012 predicted 1931
10 SASI_Mm02_00335234 predicted 751
11 SASI_Mm01_00085005 predicted 229
12 SASI_Mm01_00085007 predicted 217
13 SASI_Mm01_00085013 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030973
VALIDATED
MED25 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 25
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1486s21c1
Sequence:CCGGAGGACCTGGAGTCTCTCAAAGCTCGAGCTTTGAGAGACTCCAGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1273s21c1
Sequence:CCGGAGTGGCAAGAGAAACCCAAACCTCGAGGTTTGGGTTTCTCTTGCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-339s21c1
Sequence:CCGGACCTGGCTCGATGGCATTAAGCTCGAGCTTAATGCCATCGAGCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1438s21c1
Sequence:CCGGGCCCTTTGTTCCGGAACTCAACTCGAGTTGAGTTCCGGAACAAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-1322s1c2
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-539s1c1
Sequence:CCGGGAGAATCTTGTGCAGCAGATTCTCGAGAATCTGCTGCACAAGATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-1322s1c1
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-86s1c1
Sequence:CCGGGCCGACGTGGTGTTTGTGATTCTCGAGAATCACAAACACCACGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-284s21c1
Sequence:CCGGTCCCGAGTCCTACGTACAATGCTCGAGCATTGTACGTAGGACTCGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-488s1c1
Sequence:CCGGCCATACTTGTTGCCTGCTGTTCTCGAGAACAGCAGGCAACAAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030973
VALIDATED
MED25 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 25
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1486s21c1
Sequence:CCGGAGGACCTGGAGTCTCTCAAAGCTCGAGCTTTGAGAGACTCCAGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1273s21c1
Sequence:CCGGAGTGGCAAGAGAAACCCAAACCTCGAGGTTTGGGTTTCTCTTGCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-339s21c1
Sequence:CCGGACCTGGCTCGATGGCATTAAGCTCGAGCTTAATGCCATCGAGCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1438s21c1
Sequence:CCGGGCCCTTTGTTCCGGAACTCAACTCGAGTTGAGTTCCGGAACAAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-1322s1c2
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-539s1c1
Sequence:CCGGGAGAATCTTGTGCAGCAGATTCTCGAGAATCTGCTGCACAAGATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-1322s1c1
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-86s1c1
Sequence:CCGGGCCGACGTGGTGTTTGTGATTCTCGAGAATCACAAACACCACGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-284s21c1
Sequence:CCGGTCCCGAGTCCTACGTACAATGCTCGAGCATTGTACGTAGGACTCGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-488s1c1
Sequence:CCGGCCATACTTGTTGCCTGCTGTTCTCGAGAACAGCAGGCAACAAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030973
VALIDATED
MED25 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 25
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1486s21c1
Sequence:CCGGAGGACCTGGAGTCTCTCAAAGCTCGAGCTTTGAGAGACTCCAGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1273s21c1
Sequence:CCGGAGTGGCAAGAGAAACCCAAACCTCGAGGTTTGGGTTTCTCTTGCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-339s21c1
Sequence:CCGGACCTGGCTCGATGGCATTAAGCTCGAGCTTAATGCCATCGAGCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-1438s21c1
Sequence:CCGGGCCCTTTGTTCCGGAACTCAACTCGAGTTGAGTTCCGGAACAAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-1322s1c2
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-539s1c1
Sequence:CCGGGAGAATCTTGTGCAGCAGATTCTCGAGAATCTGCTGCACAAGATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-1322s1c1
Sequence:CCGGCCCTGCCAGGTCTACGTGAATCTCGAGATTCACGTAGACCTGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030973.1-86s1c1
Sequence:CCGGGCCGACGTGGTGTTTGTGATTCTCGAGAATCACAAACACCACGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030973.2-284s21c1
Sequence:CCGGTCCCGAGTCCTACGTACAATGCTCGAGCATTGTACGTAGGACTCGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030973.1-488s1c1
Sequence:CCGGCCATACTTGTTGCCTGCTGTTCTCGAGAACAGCAGGCAACAAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029365
VALIDATED
MED25 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 25
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029365.1-403s1c1
Sequence:CCGGGCAGCTGTTCGATGACTTTAACTCGAGTTAAAGTCATCGAACAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-1340s21c1
Sequence:CCGGGAAACTGATCATGCAGCTTATCTCGAGATAAGCTGCATGATCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-543s21c1
Sequence:CCGGTCCATCGTTTCTCCGAGAAAGCTCGAGCTTTCTCGGAGAAACGATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-265s21c1
Sequence:CCGGCCAGCAGTGCCTATGAGTTTGCTCGAGCAAACTCATAGGCACTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-367s21c1
Sequence:CCGGTGCAGCTGTTCGATGACTTTACTCGAGTAAAGTCATCGAACAGCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029365.2-323s21c1
Sequence:CCGGTGGCGAGAGCTGTAGTCTCATCTCGAGATGAGACTACAGCTCTCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029365
VALIDATED
MED25 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 25
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029365.1-403s1c1
Sequence:CCGGGCAGCTGTTCGATGACTTTAACTCGAGTTAAAGTCATCGAACAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-1340s21c1
Sequence:CCGGGAAACTGATCATGCAGCTTATCTCGAGATAAGCTGCATGATCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-543s21c1
Sequence:CCGGTCCATCGTTTCTCCGAGAAAGCTCGAGCTTTCTCGGAGAAACGATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-265s21c1
Sequence:CCGGCCAGCAGTGCCTATGAGTTTGCTCGAGCAAACTCATAGGCACTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-367s21c1
Sequence:CCGGTGCAGCTGTTCGATGACTTTACTCGAGTAAAGTCATCGAACAGCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029365.2-323s21c1
Sequence:CCGGTGGCGAGAGCTGTAGTCTCATCTCGAGATGAGACTACAGCTCTCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029365
VALIDATED
MED25 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 25
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029365.1-403s1c1
Sequence:CCGGGCAGCTGTTCGATGACTTTAACTCGAGTTAAAGTCATCGAACAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-1340s21c1
Sequence:CCGGGAAACTGATCATGCAGCTTATCTCGAGATAAGCTGCATGATCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-543s21c1
Sequence:CCGGTCCATCGTTTCTCCGAGAAAGCTCGAGCTTTCTCGGAGAAACGATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-265s21c1
Sequence:CCGGCCAGCAGTGCCTATGAGTTTGCTCGAGCAAACTCATAGGCACTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_029365.2-367s21c1
Sequence:CCGGTGCAGCTGTTCGATGACTTTACTCGAGTAAAGTCATCGAACAGCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029365.2-323s21c1
Sequence:CCGGTGGCGAGAGCTGTAGTCTCATCTCGAGATGAGACTACAGCTCTCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)