EMAIL THIS PAGE TO A FRIEND

MED26

mediator complex subunit 26

106 Gene Product Result for
Synonyms: CRSP7 CRSP70
UniProtKB ID: O95402, A1A4S3, Q0VGB6
Gene ID:
Human(9441) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Mouse(70625) mediator complex subunit 26
Rat(306328) mediator complex subunit 26
sheep(101116651) mediator complex subunit 26
naked mole-rat(101699837) mediator complex subunit 26
Domestic Rabbit(100344367) mediator complex subunit 26
domestic guinea pig(100730528) mediator complex subunit 26
fruit fly(43816) Mediator complex subunit 26
cow(506331) mediator complex subunit 26
domestic cat(101080264) mediator complex subunit 26
dog(484847) mediator complex subunit 26
chicken(771278) mediator complex subunit 26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004831 Rosetta Predictions human pricing
NM_027485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121607 predicted 810
2 SASI_Hs01_00121608 predicted 1453
3 SASI_Hs01_00121609 predicted 1464
4 SASI_Hs01_00121611 predicted 1599
5 SASI_Hs01_00121612 predicted 1693
6 SASI_Hs01_00121613 predicted 2524
7 SASI_Hs01_00121614 predicted 2406
8 SASI_Hs01_00121615 predicted 1372
9 SASI_Hs01_00121616 predicted 1883
10 SASI_Hs02_00338403 predicted 1682
11 SASI_Hs01_00121610 predicted 2521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094823 predicted 2167
2 SASI_Mm01_00094824 predicted 2044
3 SASI_Mm01_00094825 predicted 1468
4 SASI_Mm01_00094826 predicted 2221
5 SASI_Mm01_00094827 predicted 1386
6 SASI_Mm01_00094828 predicted 2226
7 SASI_Mm01_00094829 predicted 1704
8 SASI_Mm01_00094830 predicted 1996
9 SASI_Mm02_00332296 predicted 2161
10 SASI_Mm01_00094832 predicted 2181
11 SASI_Mm01_00094831 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004831
MED26 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-139s1c1
Sequence:CCGGGCACTTGAGGAAACACGACTTCTCGAGAAGTCGTGTTTCCTCAAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-124s1c1
Sequence:CCGGCCTATTACCAAAGAGGCACTTCTCGAGAAGTGCCTCTTTGGTAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1285s1c1
Sequence:CCGGCCCATGACGAGACAGATCAAACTCGAGTTTGATCTGTCTCGTCATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1446s1c1
Sequence:CCGGCAACGAGATCATCCAGTCCTACTCGAGTAGGACTGGATGATCTCGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-861s1c1
Sequence:CCGGGCAGAGCTTGTATGCACCCAACTCGAGTTGGGTGCATACAAGCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-635s21c1
Sequence:CCGGATGACCTGAAGAGCCGCAATGCTCGAGCATTGCGGCTCTTCAGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2250s21c1
Sequence:CCGGGAAATGCTGCTACCAGTTTACCTCGAGGTAAACTGGTAGCAGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-1503s21c1
Sequence:CCGGCGTCAAGCCTGTCCGGTTAAACTCGAGTTTAACCGGACAGGCTTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2371s21c1
Sequence:CCGGCAAAGAGGTGCGGACACTTTCCTCGAGGAAAGTGTCCGCACCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004831
MED26 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-139s1c1
Sequence:CCGGGCACTTGAGGAAACACGACTTCTCGAGAAGTCGTGTTTCCTCAAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-124s1c1
Sequence:CCGGCCTATTACCAAAGAGGCACTTCTCGAGAAGTGCCTCTTTGGTAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1285s1c1
Sequence:CCGGCCCATGACGAGACAGATCAAACTCGAGTTTGATCTGTCTCGTCATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1446s1c1
Sequence:CCGGCAACGAGATCATCCAGTCCTACTCGAGTAGGACTGGATGATCTCGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-861s1c1
Sequence:CCGGGCAGAGCTTGTATGCACCCAACTCGAGTTGGGTGCATACAAGCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-635s21c1
Sequence:CCGGATGACCTGAAGAGCCGCAATGCTCGAGCATTGCGGCTCTTCAGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2250s21c1
Sequence:CCGGGAAATGCTGCTACCAGTTTACCTCGAGGTAAACTGGTAGCAGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-1503s21c1
Sequence:CCGGCGTCAAGCCTGTCCGGTTAAACTCGAGTTTAACCGGACAGGCTTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2371s21c1
Sequence:CCGGCAAAGAGGTGCGGACACTTTCCTCGAGGAAAGTGTCCGCACCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004831
MED26 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-139s1c1
Sequence:CCGGGCACTTGAGGAAACACGACTTCTCGAGAAGTCGTGTTTCCTCAAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-124s1c1
Sequence:CCGGCCTATTACCAAAGAGGCACTTCTCGAGAAGTGCCTCTTTGGTAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1285s1c1
Sequence:CCGGCCCATGACGAGACAGATCAAACTCGAGTTTGATCTGTCTCGTCATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-1446s1c1
Sequence:CCGGCAACGAGATCATCCAGTCCTACTCGAGTAGGACTGGATGATCTCGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004831.2-861s1c1
Sequence:CCGGGCAGAGCTTGTATGCACCCAACTCGAGTTGGGTGCATACAAGCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-635s21c1
Sequence:CCGGATGACCTGAAGAGCCGCAATGCTCGAGCATTGCGGCTCTTCAGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2250s21c1
Sequence:CCGGGAAATGCTGCTACCAGTTTACCTCGAGGTAAACTGGTAGCAGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004831.3-1503s21c1
Sequence:CCGGCGTCAAGCCTGTCCGGTTAAACTCGAGTTTAACCGGACAGGCTTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004831.3-2371s21c1
Sequence:CCGGCAAAGAGGTGCGGACACTTTCCTCGAGGAAAGTGTCCGCACCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027485
VALIDATED
MED26 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 26
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-1789s1c1
Sequence:CCGGCGCACCACTTTATGGCTGAATCTCGAGATTCAGCCATAAAGTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-470s1c1
Sequence:CCGGGCTCATCAATGATGTCCGCAACTCGAGTTGCGGACATCATTGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027485.1-2179s1c1
Sequence:CCGGGCTACCAGTTTACTAACGATTCTCGAGAATCGTTAGTAAACTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-683s1c1
Sequence:CCGGCCTGAAGAATCGCAACGACATCTCGAGATGTCGTTGCGATTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-2036s1c1
Sequence:CCGGGCGCTTGAACATTCTGCCTTACTCGAGTAAGGCAGAATGTTCAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1161s21c1
Sequence:CCGGGGCATCGGAGCTCTTACATACCTCGAGGTATGTAAGAGCTCCGATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1966s21c1
Sequence:CCGGTGAAGACACACAGGGTAATTGCTCGAGCAATTACCCTGTGTGTCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027485.2-2234s21c1
Sequence:CCGGATGGCTGAAATCTATAGTAAGCTCGAGCTTACTATAGATTTCAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027485.2-1510s21c1
Sequence:CCGGTGTTAAACCTGTGCGGTTAAACTCGAGTTTAACCGCACAGGTTTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1707s21c1
Sequence:CCGGTATCACGAAATGAGATCATACCTCGAGGTATGATCTCATTTCGTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027485
VALIDATED
MED26 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 26
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-1789s1c1
Sequence:CCGGCGCACCACTTTATGGCTGAATCTCGAGATTCAGCCATAAAGTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-470s1c1
Sequence:CCGGGCTCATCAATGATGTCCGCAACTCGAGTTGCGGACATCATTGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027485.1-2179s1c1
Sequence:CCGGGCTACCAGTTTACTAACGATTCTCGAGAATCGTTAGTAAACTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-683s1c1
Sequence:CCGGCCTGAAGAATCGCAACGACATCTCGAGATGTCGTTGCGATTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-2036s1c1
Sequence:CCGGGCGCTTGAACATTCTGCCTTACTCGAGTAAGGCAGAATGTTCAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1161s21c1
Sequence:CCGGGGCATCGGAGCTCTTACATACCTCGAGGTATGTAAGAGCTCCGATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1966s21c1
Sequence:CCGGTGAAGACACACAGGGTAATTGCTCGAGCAATTACCCTGTGTGTCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027485.2-2234s21c1
Sequence:CCGGATGGCTGAAATCTATAGTAAGCTCGAGCTTACTATAGATTTCAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027485.2-1510s21c1
Sequence:CCGGTGTTAAACCTGTGCGGTTAAACTCGAGTTTAACCGCACAGGTTTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1707s21c1
Sequence:CCGGTATCACGAAATGAGATCATACCTCGAGGTATGATCTCATTTCGTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027485
VALIDATED
MED26 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 26
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-1789s1c1
Sequence:CCGGCGCACCACTTTATGGCTGAATCTCGAGATTCAGCCATAAAGTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-470s1c1
Sequence:CCGGGCTCATCAATGATGTCCGCAACTCGAGTTGCGGACATCATTGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027485.1-2179s1c1
Sequence:CCGGGCTACCAGTTTACTAACGATTCTCGAGAATCGTTAGTAAACTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-683s1c1
Sequence:CCGGCCTGAAGAATCGCAACGACATCTCGAGATGTCGTTGCGATTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027485.1-2036s1c1
Sequence:CCGGGCGCTTGAACATTCTGCCTTACTCGAGTAAGGCAGAATGTTCAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1161s21c1
Sequence:CCGGGGCATCGGAGCTCTTACATACCTCGAGGTATGTAAGAGCTCCGATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1966s21c1
Sequence:CCGGTGAAGACACACAGGGTAATTGCTCGAGCAATTACCCTGTGTGTCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027485.2-2234s21c1
Sequence:CCGGATGGCTGAAATCTATAGTAAGCTCGAGCTTACTATAGATTTCAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027485.2-1510s21c1
Sequence:CCGGTGTTAAACCTGTGCGGTTAAACTCGAGTTTAACCGCACAGGTTTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027485.2-1707s21c1
Sequence:CCGGTATCACGAAATGAGATCATACCTCGAGGTATGATCTCATTTCGTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)