EMAIL THIS PAGE TO A FRIEND

MED27

mediator complex subunit 27

78 Gene Product Result for
Synonyms: CRAP34 CRSP34 CRSP8 TRAP37
Gene ID:
Human(9442) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Mouse(68975) mediator complex subunit 27
Rat(296612) mediator complex subunit 27
Zebrafish(393633) mediator complex subunit 27
chicken(417172) mediator complex subunit 27
cow(525389) mediator complex subunit 27
domestic cat(101088890) mediator complex subunit 27
dog(612800) mediator complex subunit 27
fruit fly(40696) Mediator complex subunit 27
domestic guinea pig(100725304) mediator complex subunit 27
naked mole-rat(101713818) mediator complex subunit 27
sheep(101120912) mediator complex subunit 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004269 Rosetta Predictions human pricing
NM_001106565 Rosetta Predictions rat pricing
NM_026896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337235 predicted 700
2 SASI_Hs02_00337236 predicted 644
3 SASI_Hs02_00337237 predicted 405
4 SASI_Hs02_00337238 predicted 683
5 SASI_Hs02_00337239 predicted 423
6 SASI_Hs02_00337240 predicted 438
7 SASI_Hs02_00337241 predicted 335
8 SASI_Hs02_00337242 predicted 286
9 SASI_Hs02_00337243 predicted 661
10 SASI_Hs02_00337244 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220208 predicted 516
2 SASI_Rn02_00220209 predicted 728
3 SASI_Rn02_00220210 predicted 1028
4 SASI_Rn02_00220211 predicted 737
5 SASI_Rn02_00220212 predicted 560
6 SASI_Rn02_00220213 predicted 212
7 SASI_Rn02_00220214 predicted 509
8 SASI_Rn02_00220215 predicted 705
9 SASI_Rn02_00220216 predicted 449
10 SASI_Rn02_00220217 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066618 predicted 686
2 SASI_Mm01_00066619 predicted 245
3 SASI_Mm01_00066620 predicted 338
4 SASI_Mm01_00066621 predicted 626
5 SASI_Mm01_00066622 predicted 358
6 SASI_Mm02_00331167 predicted 857
7 SASI_Mm01_00066623 predicted 671
8 SASI_Mm01_00066624 predicted 199
9 SASI_Mm01_00066625 predicted 325
10 SASI_Mm01_00066626 predicted 549
11 SASI_Mm01_00066627 predicted 248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004269
VALIDATED
MED27 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004269.2-1072s21c1
Sequence:CCGGCTTTCATAAAGCAGCGCCATGCTCGAGCATGGCGCTGCTTTATGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004269.2-1103s21c1
Sequence:CCGGCCACTCTTGAAGAGCAGACTCCTCGAGGAGTCTGCTCTTCAAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-825s21c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-639s1c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-825s1c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-326s1c1
Sequence:CCGGCCTCTCTATAGTCAACTCCTTCTCGAGAAGGAGTTGACTATAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-429s1c1
Sequence:CCGGCCGCTAATCAGATGGGAGTATCTCGAGATACTCCCATCTGATTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-639s21c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-542s1c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-542s21c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004269
VALIDATED
MED27 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004269.2-1072s21c1
Sequence:CCGGCTTTCATAAAGCAGCGCCATGCTCGAGCATGGCGCTGCTTTATGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004269.2-1103s21c1
Sequence:CCGGCCACTCTTGAAGAGCAGACTCCTCGAGGAGTCTGCTCTTCAAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-825s21c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-639s1c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-825s1c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-326s1c1
Sequence:CCGGCCTCTCTATAGTCAACTCCTTCTCGAGAAGGAGTTGACTATAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-429s1c1
Sequence:CCGGCCGCTAATCAGATGGGAGTATCTCGAGATACTCCCATCTGATTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-639s21c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-542s1c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-542s21c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004269
VALIDATED
MED27 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330486    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004269.2-1072s21c1
Sequence:CCGGCTTTCATAAAGCAGCGCCATGCTCGAGCATGGCGCTGCTTTATGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004269.2-1103s21c1
Sequence:CCGGCCACTCTTGAAGAGCAGACTCCTCGAGGAGTCTGCTCTTCAAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-825s21c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-639s1c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-825s1c1
Sequence:CCGGCCTGGTTAAGAAGTTACATAACTCGAGTTATGTAACTTCTTAACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-326s1c1
Sequence:CCGGCCTCTCTATAGTCAACTCCTTCTCGAGAAGGAGTTGACTATAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004269.2-429s1c1
Sequence:CCGGCCGCTAATCAGATGGGAGTATCTCGAGATACTCCCATCTGATTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-639s21c1
Sequence:CCGGGCCTGTTCATTGATCGAACAACTCGAGTTGTTCGATCAATGAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_004269.2-542s1c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004269.2-542s21c1
Sequence:CCGGCCTGAAATGTCCATCCACTTACTCGAGTAAGTGGATGGACATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026896
MED27 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 27
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-812s21c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-754s21c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-207s21c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026896.4-1009s21c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-813s1c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-539s21c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026896.1-1010s1c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-755s1c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-208s1c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-540s1c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026896
MED27 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 27
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-812s21c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-754s21c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-207s21c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026896.4-1009s21c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-813s1c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-539s21c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026896.1-1010s1c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-755s1c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-208s1c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-540s1c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026896
MED27 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 27
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-812s21c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-754s21c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-207s21c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026896.4-1009s21c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-813s1c1
Sequence:CCGGCCTGGCTGAGAAGCTACATTACTCGAGTAATGTAGCTTCTCAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026896.4-539s21c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026896.1-1010s1c1
Sequence:CCGGCATTCACCACACAGGAGTCTACTCGAGTAGACTCCTGTGTGGTGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-755s1c1
Sequence:CCGGGCCCTGCTTCACTATCAGTTACTCGAGTAACTGATAGTGAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-208s1c1
Sequence:CCGGCCTCAATGAACTGGAACGTTTCTCGAGAAACGTTCCAGTTCATTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026896.1-540s1c1
Sequence:CCGGCCATTCACTTATCGAGACCCACTCGAGTGGGTCTCGATAAGTGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)