EMAIL THIS PAGE TO A FRIEND

MED28

mediator complex subunit 28

87 Gene Product Result for
Synonyms: 1500003D12Rik EG1 magicin
UniProtKB ID: Q9H204, Q9BZJ5
Gene ID:
Mouse(66999) mediator of RNA polymerase II transcription, subunit 28 homolog (yeast)
Rat(305391) mediator complex subunit 28
sheep(101121011) mediator complex subunit 28
naked mole-rat(101712593) mediator complex subunit 28
domestic guinea pig(100717624) mediator complex subunit 28
Zebrafish(493610) mediator complex subunit 28
cow(513972) mediator complex subunit 28
domestic cat(101086307) mediator complex subunit 28
dog(488813) mediator complex subunit 28
fruit fly(43079) Mediator complex subunit 28
chicken(425350) mediator complex subunit 28
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025205 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025205 Rosetta Predictions human pricing
NM_001107217 Rosetta Predictions rat pricing
NM_025895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151292 predicted 438
2 SASI_Hs01_00151294 predicted 366
3 SASI_Hs01_00151296 predicted 361
4 SASI_Hs01_00151298 predicted 269
5 SASI_Hs02_00357980 predicted 987
6 SASI_Hs01_00151299 predicted 304
7 SASI_Hs01_00151301 predicted 443
8 SASI_Hs02_00357981 predicted 208
9 SASI_Hs02_00357982 predicted 239
10 SASI_Hs01_00151293 predicted 340
11 SASI_Hs01_00151295 predicted 337
12 SASI_Hs01_00151297 predicted 311
13 SASI_Hs01_00151300 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226665 predicted 393
2 SASI_Rn02_00226666 predicted 371
3 SASI_Rn02_00226667 predicted 336
4 SASI_Rn02_00226668 predicted 392
5 SASI_Rn02_00226669 predicted 205
6 SASI_Rn02_00226670 predicted 213
7 SASI_Rn02_00226671 predicted 348
8 SASI_Rn02_00226672 predicted 410
9 SASI_Rn02_00226673 predicted 487
10 SASI_Rn02_00226674 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103861 predicted 899
2 SASI_Mm01_00103862 predicted 884
3 SASI_Mm01_00103863 predicted 404
4 SASI_Mm01_00103864 predicted 784
5 SASI_Mm01_00103866 predicted 908
6 SASI_Mm01_00103867 predicted 830
7 SASI_Mm01_00103868 predicted 385
8 SASI_Mm01_00103869 predicted 711
9 SASI_Mm01_00103870 predicted 571
10 SASI_Mm02_00329246 predicted 672
11 SASI_Mm01_00103865 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025205
VALIDATED
MED28 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 28
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_025205.1-333s1c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-198s1c1
Sequence:CCGGGACTATGTCAATGGCACCGATCTCGAGATCGGTGCCATTGACATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-444s1c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-214s1c1
Sequence:CCGGCCGATCAGGAAGAAATTCGAACTCGAGTTCGAATTTCTTCCTGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-322s1c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025205.3-445s21c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-323s21c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-334s21c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-748s21c1
Sequence:CCGGTGGATAAACCAAGTAAGTATTCTCGAGAATACTTACTTGGTTTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-148s21c1
Sequence:CCGGGACGAGTTGGAGTCATCTTTCCTCGAGGAAAGATGACTCCAACTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025205
VALIDATED
MED28 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 28
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_025205.1-333s1c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-198s1c1
Sequence:CCGGGACTATGTCAATGGCACCGATCTCGAGATCGGTGCCATTGACATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-444s1c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-214s1c1
Sequence:CCGGCCGATCAGGAAGAAATTCGAACTCGAGTTCGAATTTCTTCCTGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-322s1c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025205.3-445s21c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-323s21c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-334s21c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-748s21c1
Sequence:CCGGTGGATAAACCAAGTAAGTATTCTCGAGAATACTTACTTGGTTTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-148s21c1
Sequence:CCGGGACGAGTTGGAGTCATCTTTCCTCGAGGAAAGATGACTCCAACTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025205
VALIDATED
MED28 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 28
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_025205.1-333s1c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-198s1c1
Sequence:CCGGGACTATGTCAATGGCACCGATCTCGAGATCGGTGCCATTGACATAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-444s1c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025205.1-214s1c1
Sequence:CCGGCCGATCAGGAAGAAATTCGAACTCGAGTTCGAATTTCTTCCTGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025205.1-322s1c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025205.3-445s21c1
Sequence:CCGGGACATCAACGTGCAGCACAAACTCGAGTTTGTGCTGCACGTTGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-323s21c1
Sequence:CCGGTCCAGAAACCAGAGCAAGTTACTCGAGTAACTTGCTCTGGTTTCTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-334s21c1
Sequence:CCGGGAGCAAGTTATCAAAGAGGATCTCGAGATCCTCTTTGATAACTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-748s21c1
Sequence:CCGGTGGATAAACCAAGTAAGTATTCTCGAGAATACTTACTTGGTTTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_025205.3-148s21c1
Sequence:CCGGGACGAGTTGGAGTCATCTTTCCTCGAGGAAAGATGACTCCAACTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025895
VALIDATED
MED28 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 28
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025895.2-686s1c1
Sequence:CCGGCCTATTTATAAGGTAGGGTTTCTCGAGAAACCCTACCTTATAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-210s1c1
Sequence:CCGGCTTCCCTTGTGAGTCAGGATTCTCGAGAATCCTGACTCACAAGGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-150s1c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-272s1c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-434s1c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-699s21c1
Sequence:CCGGATCAGTTTCTGTCCCTATTTACTCGAGTAAATAGGGACAGAAACTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-184s21c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-306s21c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-386s21c1
Sequence:CCGGCCAGAAACCAGATCAAGTTATCTCGAGATAACTTGATCTGGTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025895.3-468s21c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.4-410s21c1
Sequence:CCGGCAGAAACCAGATCAAGTTATCCTCGAGGATAACTTGATCTGGTTTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025895
VALIDATED
MED28 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 28
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025895.2-686s1c1
Sequence:CCGGCCTATTTATAAGGTAGGGTTTCTCGAGAAACCCTACCTTATAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-210s1c1
Sequence:CCGGCTTCCCTTGTGAGTCAGGATTCTCGAGAATCCTGACTCACAAGGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-150s1c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-272s1c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-434s1c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-699s21c1
Sequence:CCGGATCAGTTTCTGTCCCTATTTACTCGAGTAAATAGGGACAGAAACTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-184s21c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-306s21c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-386s21c1
Sequence:CCGGCCAGAAACCAGATCAAGTTATCTCGAGATAACTTGATCTGGTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025895.3-468s21c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.4-410s21c1
Sequence:CCGGCAGAAACCAGATCAAGTTATCCTCGAGGATAACTTGATCTGGTTTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025895
VALIDATED
MED28 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 28
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025895.2-686s1c1
Sequence:CCGGCCTATTTATAAGGTAGGGTTTCTCGAGAAACCCTACCTTATAAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-210s1c1
Sequence:CCGGCTTCCCTTGTGAGTCAGGATTCTCGAGAATCCTGACTCACAAGGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025895.2-150s1c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-272s1c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025895.2-434s1c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-699s21c1
Sequence:CCGGATCAGTTTCTGTCCCTATTTACTCGAGTAAATAGGGACAGAAACTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-184s21c1
Sequence:CCGGCGAGACCATCTAACAGCACTTCTCGAGAAGTGCTGTTAGATGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-306s21c1
Sequence:CCGGGATCAGTGTATCCAGAAGTTTCTCGAGAAACTTCTGGATACACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.3-386s21c1
Sequence:CCGGCCAGAAACCAGATCAAGTTATCTCGAGATAACTTGATCTGGTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025895.3-468s21c1
Sequence:CCGGCACTTGACAAAGCTGAGGCATCTCGAGATGCCTCAGCTTTGTCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025895.4-410s21c1
Sequence:CCGGCAGAAACCAGATCAAGTTATCCTCGAGGATAACTTGATCTGGTTTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)