EMAIL THIS PAGE TO A FRIEND

MED29

mediator complex subunit 29

45 Gene Product Result for
Synonyms: IXL
UniProtKB ID: Q9NX70, Q5XX09, Q9NTF4
Gene ID:
Human(55588) Summary: MED29 is a subunit of the Mediator complex, a multiprotein coactivator of RNA transcription that interacts with DNA-bound transcriptional activators, RNA polymerase II (see MIM 180660), and general initiation factors (Sato et al., 2003 [PubMed 14576168]
Mouse(67224) mediator complex subunit 29
Rat(292751) mediator complex subunit 29
Zebrafish(797134) mediator complex subunit 29
dog(612535) mediator complex subunit 29
domestic cat(101097115) mediator complex subunit 29
cow(614626) mediator complex subunit 29
domestic guinea pig(100732553) mediator complex subunit 29
naked mole-rat(101697551) mediator complex subunit 29
sheep(101116674) mediator complex subunit 29
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017592 Rosetta Predictions human pricing
NM_001106237 Rosetta Predictions rat pricing
NM_026042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236896 predicted 459
2 SASI_Hs01_00236897 predicted 348
3 SASI_Hs01_00236898 predicted 566
4 SASI_Hs01_00236899 predicted 644
5 SASI_Hs01_00236900 predicted 906
6 SASI_Hs01_00236901 predicted 257
7 SASI_Hs01_00236902 predicted 580
8 SASI_Hs01_00236903 predicted 590
9 SASI_Hs01_00236904 predicted 1061
10 SASI_Hs01_00236905 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216988 predicted 594
2 SASI_Rn02_00216989 predicted 698
3 SASI_Rn02_00216990 predicted 521
4 SASI_Rn02_00216991 predicted 289
5 SASI_Rn02_00216992 predicted 301
6 SASI_Rn02_00216993 predicted 537
7 SASI_Rn02_00216994 predicted 250
8 SASI_Rn02_00216995 predicted 531
9 SASI_Rn02_00216996 predicted 334
10 SASI_Rn02_00216997 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032998 predicted 890
2 SASI_Mm01_00032999 predicted 658
3 SASI_Mm01_00033000 predicted 256
4 SASI_Mm01_00033001 predicted 629
5 SASI_Mm01_00033002 predicted 499
6 SASI_Mm01_00033003 predicted 475
7 SASI_Mm02_00329546 predicted 239
8 SASI_Mm02_00329547 predicted 884
9 SASI_Mm01_00033005 predicted 256
10 SASI_Mm01_00033006 predicted 498
11 SASI_Mm01_00033004 predicted 312
12 SASI_Mm01_00033007 predicted 729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017592
MED29 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 29
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000424751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017592.1-305s21c1
Sequence:CCGGGAGAGTCTACAGACCTTGATGCTCGAGCATCAAGGTCTGTAGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017592.1-903s21c1
Sequence:CCGGCCTAGCCTAGGGTAGACTTTGCTCGAGCAAAGTCTACCCTAGGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017592
MED29 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 29
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000424751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017592.1-305s21c1
Sequence:CCGGGAGAGTCTACAGACCTTGATGCTCGAGCATCAAGGTCTGTAGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017592.1-903s21c1
Sequence:CCGGCCTAGCCTAGGGTAGACTTTGCTCGAGCAAAGTCTACCCTAGGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017592
MED29 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 29
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000424751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017592.1-305s21c1
Sequence:CCGGGAGAGTCTACAGACCTTGATGCTCGAGCATCAAGGTCTGTAGACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422801    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017592.1-903s21c1
Sequence:CCGGCCTAGCCTAGGGTAGACTTTGCTCGAGCAAAGTCTACCCTAGGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026042
VALIDATED
MED29 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 29
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-252s21c1
Sequence:CCGGTGATTCAGAACACTAACATTGCTCGAGCAATGTTAGTGTTCTGAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-483s21c1
Sequence:CCGGAGTACCTGGCTGTCATCAAAGCTCGAGCTTTGATGACAGCCAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-304s21c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026042.2-816s21c1
Sequence:CCGGTTCCCACTGGGCCGATGATTACTCGAGTAATCATCGGCCCAGTGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026042.2-514s21c1
Sequence:CCGGCTGTGCCAAAGACATTCATACCTCGAGGTATGAATGTCTTTGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026042.2-304s1c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-1009s1c1
Sequence:CCGGGATCGTATTATACAAGAGGAACTCGAGTTCCTCTTGTATAATACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-916s1c1
Sequence:CCGGCCCAGTGTATGGATTTCCTTTCTCGAGAAAGGAAATCCATACACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-690s1c1
Sequence:CCGGGCCACAGTAATGCAGCTGAAACTCGAGTTTCAGCTGCATTACTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026042
VALIDATED
MED29 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 29
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-252s21c1
Sequence:CCGGTGATTCAGAACACTAACATTGCTCGAGCAATGTTAGTGTTCTGAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-483s21c1
Sequence:CCGGAGTACCTGGCTGTCATCAAAGCTCGAGCTTTGATGACAGCCAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-304s21c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026042.2-816s21c1
Sequence:CCGGTTCCCACTGGGCCGATGATTACTCGAGTAATCATCGGCCCAGTGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026042.2-514s21c1
Sequence:CCGGCTGTGCCAAAGACATTCATACCTCGAGGTATGAATGTCTTTGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026042.2-304s1c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-1009s1c1
Sequence:CCGGGATCGTATTATACAAGAGGAACTCGAGTTCCTCTTGTATAATACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-916s1c1
Sequence:CCGGCCCAGTGTATGGATTTCCTTTCTCGAGAAAGGAAATCCATACACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-690s1c1
Sequence:CCGGGCCACAGTAATGCAGCTGAAACTCGAGTTTCAGCTGCATTACTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026042
VALIDATED
MED29 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 29
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-252s21c1
Sequence:CCGGTGATTCAGAACACTAACATTGCTCGAGCAATGTTAGTGTTCTGAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-483s21c1
Sequence:CCGGAGTACCTGGCTGTCATCAAAGCTCGAGCTTTGATGACAGCCAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026042.2-304s21c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026042.2-816s21c1
Sequence:CCGGTTCCCACTGGGCCGATGATTACTCGAGTAATCATCGGCCCAGTGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026042.2-514s21c1
Sequence:CCGGCTGTGCCAAAGACATTCATACCTCGAGGTATGAATGTCTTTGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026042.2-304s1c1
Sequence:CCGGGCAGCGCTTTGACAAGTGTTTCTCGAGAAACACTTGTCAAAGCGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191677    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-1009s1c1
Sequence:CCGGGATCGTATTATACAAGAGGAACTCGAGTTCCTCTTGTATAATACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-916s1c1
Sequence:CCGGCCCAGTGTATGGATTTCCTTTCTCGAGAAAGGAAATCCATACACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202252    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026042.2-690s1c1
Sequence:CCGGGCCACAGTAATGCAGCTGAAACTCGAGTTTCAGCTGCATTACTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290829
VALIDATED
MED29 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 29
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-447s1c1
Sequence:CCGGACAGAGTTGTGACAGTGCCAACTCGAGTTGGCACTGTCACAACTCTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290829.3-2954s1c1
Sequence:CCGGGCCTGTATTTGTGGAGCTGATCTCGAGATCAGCTCCACAAATACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-234s1c1
Sequence:CCGGGCAGCGTTATAAGATGCTCATCTCGAGATGAGCATCTTATAACGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-548s1c1
Sequence:CCGGCGGTCATCAAAGCCCAGATTTCTCGAGAAATCTGGGCTTTGATGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-313s1c1
Sequence:CCGGCAGAACACTAACATCGACAATCTCGAGATTGTCGATGTTAGTGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290829
VALIDATED
MED29 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 29
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-447s1c1
Sequence:CCGGACAGAGTTGTGACAGTGCCAACTCGAGTTGGCACTGTCACAACTCTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290829.3-2954s1c1
Sequence:CCGGGCCTGTATTTGTGGAGCTGATCTCGAGATCAGCTCCACAAATACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-234s1c1
Sequence:CCGGGCAGCGTTATAAGATGCTCATCTCGAGATGAGCATCTTATAACGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-548s1c1
Sequence:CCGGCGGTCATCAAAGCCCAGATTTCTCGAGAAATCTGGGCTTTGATGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-313s1c1
Sequence:CCGGCAGAACACTAACATCGACAATCTCGAGATTGTCGATGTTAGTGTTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290829
VALIDATED
MED29 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 29
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-447s1c1
Sequence:CCGGACAGAGTTGTGACAGTGCCAACTCGAGTTGGCACTGTCACAACTCTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_290829.3-2954s1c1
Sequence:CCGGGCCTGTATTTGTGGAGCTGATCTCGAGATCAGCTCCACAAATACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290829.3-234s1c1
Sequence:CCGGGCAGCGTTATAAGATGCTCATCTCGAGATGAGCATCTTATAACGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-548s1c1
Sequence:CCGGCGGTCATCAAAGCCCAGATTTCTCGAGAAATCTGGGCTTTGATGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290829.3-313s1c1
Sequence:CCGGCAGAACACTAACATCGACAATCTCGAGATTGTCGATGTTAGTGTTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)