EMAIL THIS PAGE TO A FRIEND

MED30

mediator complex subunit 30

56 Gene Product Result for
Synonyms: MED30S THRAP6 TRAP25
UniProtKB ID: Q96HR3
Gene ID:
Human(90390) Summary: The multiprotein TRAP/Mediator complex facilitates gene expression through a wide variety of transcriptional activators. MED30 is a component of this complex that appears to be metazoan specific (Baek et al., 2002 [PubMed 11909976]
Mouse(69790) mediator complex subunit 30
Rat(299905) mediator complex subunit 30
sheep(101120338) mediator complex subunit 30
naked mole-rat(101705909) mediator complex subunit 30
domestic guinea pig(100716693) mediator complex subunit 30
Zebrafish(393690) mediator complex subunit 30
cow(613879) mediator complex subunit 30
domestic cat(101096638) mediator complex subunit 30
dog(482023) mediator complex subunit 30
chicken(420284) mediator complex subunit 30
fruit fly(38078) Mediator complex subunit 30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027212 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027212 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027212 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080651 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080651 Rosetta Predictions human pricing
NM_001130539 Rosetta Predictions rat pricing
NM_027212 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362401 predicted 318
2 SASI_Hs01_00044965 predicted 322
3 SASI_Hs02_00362402 predicted 409
4 SASI_Hs01_00044966 predicted 417
5 SASI_Hs01_00044967 predicted 298
6 SASI_Hs01_00044968 predicted 407
7 SASI_Hs01_00044969 predicted 414
8 SASI_Hs01_00044971 predicted 199
9 SASI_Hs01_00044972 predicted 284
10 SASI_Hs01_00044973 predicted 396
11 SASI_Hs01_00044964 predicted 441
12 SASI_Hs01_00044970 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255579 predicted 267
2 SASI_Rn02_00255580 predicted 317
3 SASI_Rn02_00255581 predicted 273
4 SASI_Rn02_00255582 predicted 361
5 SASI_Rn02_00255583 predicted 287
6 SASI_Rn02_00255584 predicted 247
7 SASI_Rn02_00255585 predicted 356
8 SASI_Rn02_00255586 predicted 259
9 SASI_Rn02_00255587 predicted 332
10 SASI_Rn02_00255588 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195897 predicted 343
2 SASI_Mm01_00195898 predicted 247
3 SASI_Mm01_00195899 predicted 473
4 SASI_Mm01_00195900 predicted 302
5 SASI_Mm01_00195901 predicted 235
6 SASI_Mm01_00195902 predicted 480
7 SASI_Mm01_00195903 predicted 245
8 SASI_Mm01_00195904 predicted 411
9 SASI_Mm01_00195905 predicted 311
10 SASI_Mm01_00195906 predicted 277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027212
VALIDATED
MED30 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-657s1c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-482s1c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-344s1c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-534s1c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-556s1c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-481s21c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-343s21c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027212.2-656s21c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-555s21c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-533s21c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027212
VALIDATED
MED30 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-657s1c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-482s1c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-344s1c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-534s1c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-556s1c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-481s21c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-343s21c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027212.2-656s21c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-555s21c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-533s21c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027212
VALIDATED
MED30 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125049    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-657s1c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-482s1c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-344s1c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027212.1-534s1c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027212.1-556s1c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-481s21c1
Sequence:CCGGGACGAGAAATTGTAGAAGTAACTCGAGTTACTTCTACAATTTCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-343s21c1
Sequence:CCGGGACTGGTCTATGACAAATGTACTCGAGTACATTTGTCATAGACCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027212.2-656s21c1
Sequence:CCGGCCTCTTGAGTATTCCTCCCTTCTCGAGAAGGGAGGAATACTCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-555s21c1
Sequence:CCGGCGGAATCTCATCTGGGACATACTCGAGTATGTCCCAGATGAGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027212.2-533s21c1
Sequence:CCGGGAAGCAGATTATGGATCAATTCTCGAGAATTGATCCATAATCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080651
VALIDATED
MED30 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 30
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-263s1c1
Sequence:CCGGGCTGCCAAATGGTGTCACTTACTCGAGTAAGTGACACCATTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-503s1c1
Sequence:CCGGGCGAGAAATTGCTGAAGTAAACTCGAGTTTACTTCAGCAATTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-576s1c1
Sequence:CCGGCGAAATCTCATCTGGGATATACTCGAGTATATCCCAGATGAGATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080651.1-306s1c1
Sequence:CCGGCGGTTAACAAAGCTACAGGATCTCGAGATCCTGTAGCTTTGTTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-359s1c1
Sequence:CCGGGCTGAGATTGGTATATGACAACTCGAGTTGTCATATACCAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-678s21c1
Sequence:CCGGTGAGGAACTAAGCTGATATTTCTCGAGAAATATCAGCTTAGTTCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-388s21c1
Sequence:CCGGGGATAATCTTCGCCAACTTTCCTCGAGGAAAGTTGGCGAAGATTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080651.2-705s21c1
Sequence:CCGGCCTGCTTTACACATGTTATACCTCGAGGTATAACATGTGTAAAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080651
VALIDATED
MED30 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 30
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-263s1c1
Sequence:CCGGGCTGCCAAATGGTGTCACTTACTCGAGTAAGTGACACCATTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-503s1c1
Sequence:CCGGGCGAGAAATTGCTGAAGTAAACTCGAGTTTACTTCAGCAATTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-576s1c1
Sequence:CCGGCGAAATCTCATCTGGGATATACTCGAGTATATCCCAGATGAGATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080651.1-306s1c1
Sequence:CCGGCGGTTAACAAAGCTACAGGATCTCGAGATCCTGTAGCTTTGTTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-359s1c1
Sequence:CCGGGCTGAGATTGGTATATGACAACTCGAGTTGTCATATACCAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-678s21c1
Sequence:CCGGTGAGGAACTAAGCTGATATTTCTCGAGAAATATCAGCTTAGTTCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-388s21c1
Sequence:CCGGGGATAATCTTCGCCAACTTTCCTCGAGGAAAGTTGGCGAAGATTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080651.2-705s21c1
Sequence:CCGGCCTGCTTTACACATGTTATACCTCGAGGTATAACATGTGTAAAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080651
VALIDATED
MED30 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 30
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-263s1c1
Sequence:CCGGGCTGCCAAATGGTGTCACTTACTCGAGTAAGTGACACCATTTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-503s1c1
Sequence:CCGGGCGAGAAATTGCTGAAGTAAACTCGAGTTTACTTCAGCAATTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-576s1c1
Sequence:CCGGCGAAATCTCATCTGGGATATACTCGAGTATATCCCAGATGAGATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080651.1-306s1c1
Sequence:CCGGCGGTTAACAAAGCTACAGGATCTCGAGATCCTGTAGCTTTGTTAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_080651.1-359s1c1
Sequence:CCGGGCTGAGATTGGTATATGACAACTCGAGTTGTCATATACCAATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-678s21c1
Sequence:CCGGTGAGGAACTAAGCTGATATTTCTCGAGAAATATCAGCTTAGTTCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080651.2-388s21c1
Sequence:CCGGGGATAATCTTCGCCAACTTTCCTCGAGGAAAGTTGGCGAAGATTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413310    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080651.2-705s21c1
Sequence:CCGGCCTGCTTTACACATGTTATACCTCGAGGTATAACATGTGTAAAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)