EMAIL THIS PAGE TO A FRIEND

MED31

mediator complex subunit 31

82 Gene Product Result for
Synonyms: 3110004H13Rik Soh1
UniProtKB ID: Q9Y3C7, B2R4L9
Gene ID:
Mouse(67279) mediator of RNA polymerase II transcription, subunit 31 homolog (yeast)
Rat(287475) mediator complex subunit 31
Zebrafish(436690) mediator of RNA polymerase II transcription, subunit 31 homolog (yeast)
cow(532868) mediator complex subunit 31
domestic cat(101089908) mediator complex subunit 31
dog(607000) mediator complex subunit 31
chicken(417679) mediator complex subunit 31
Thale Cress(832113) mediator of RNA polymerase II transcription subunit 31
fruit fly(40577) Mediator complex subunit 31
domestic guinea pig(100724471) mediator complex subunit 31
naked mole-rat(101705335) mediator complex subunit 31
sheep(101104161) mediator complex subunit 31
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016060 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016060 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016060 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU048451 MISSION® esiRNA esiRNA targeting mouse Med31 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016060 Rosetta Predictions human pricing
XM_001080168 Rosetta Predictions rat pricing
XM_213393 Rosetta Predictions rat pricing
NM_026068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244515 predicted 939
2 SASI_Hs02_00348790 predicted 935
3 SASI_Hs01_00244516 predicted 321
4 SASI_Hs01_00244517 predicted 858
5 SASI_Hs02_00348791 predicted 210
6 SASI_Hs01_00244518 predicted 878
7 SASI_Hs01_00244520 predicted 899
8 SASI_Hs01_00244521 predicted 910
9 SASI_Hs01_00244523 predicted 841
10 SASI_Hs02_00348792 predicted 281
11 SASI_Hs01_00244514 predicted 793
12 SASI_Hs01_00244519 predicted 289
13 SASI_Hs01_00244522 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366904 predicted 878
2 SASI_Rn02_00366905 predicted 684
3 SASI_Rn02_00366906 predicted 676
4 SASI_Rn02_00366907 predicted 648
5 SASI_Rn02_00366908 predicted 660
6 SASI_Rn02_00366909 predicted 631
7 SASI_Rn02_00366910 predicted 929
8 SASI_Rn02_00366911 predicted 648
9 SASI_Rn02_00366912 predicted 761
10 SASI_Rn02_00366913 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213393 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374579 predicted 877
2 SASI_Rn02_00374580 predicted 931
3 SASI_Rn02_00374581 predicted 840
4 SASI_Rn02_00374582 predicted 852
5 SASI_Rn02_00374583 predicted 926
6 SASI_Rn02_00374584 predicted 901
7 SASI_Rn02_00374585 predicted 900
8 SASI_Rn02_00374586 predicted 837
9 SASI_Rn02_00374587 predicted 826
10 SASI_Rn02_00374588 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124219 predicted 633
2 SASI_Mm02_00329613 predicted 803
3 SASI_Mm02_00329614 predicted 649
4 SASI_Mm01_00124220 predicted 709
5 SASI_Mm01_00124221 predicted 928
6 SASI_Mm01_00124223 predicted 777
7 SASI_Mm01_00124224 predicted 687
8 SASI_Mm01_00124225 predicted 775
9 SASI_Mm01_00124226 predicted 876
10 SASI_Mm01_00124228 predicted 619
11 SASI_Mm01_00124222 predicted 670
12 SASI_Mm01_00124227 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016060
VALIDATED
MED31 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-219s21c1
Sequence:CCGGCCCAAAGAGGTTACTTCAAAGCTCGAGCTTTGAAGTAACCTCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-298s21c1
Sequence:CCGGCAAGTATCTAAAGTACCCTCACTCGAGTGAGGGTACTTTAGATACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-315s1c1
Sequence:CCGGCCAATATGAACACTTCCGAAACTCGAGTTTCGGAAGTGTTCATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-153s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_016060.1-286s1c1
Sequence:CCGGCCTCAGTGTTTACACATGTTACTCGAGTAACATGTGTAAACACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-127s1c1
Sequence:CCGGCGGTTTCAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGAAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-259s1c1
Sequence:CCGGCCAGAATATGCCAAGTATCTACTCGAGTAGATACTTGGCATATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-166s21c1
Sequence:CCGGGGAGTTGGAATTTGTGCAATGCTCGAGCATTGCACAAATTCCAACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-134s21c1
Sequence:CCGGGATGATGCTGGAAATCGACTTCTCGAGAAGTCGATTTCCAGCATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-329s21c1
Sequence:CCGGATGTTAGAGCTGCTCCAATATCTCGAGATATTGGAGCAGCTCTAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016060
VALIDATED
MED31 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-219s21c1
Sequence:CCGGCCCAAAGAGGTTACTTCAAAGCTCGAGCTTTGAAGTAACCTCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-298s21c1
Sequence:CCGGCAAGTATCTAAAGTACCCTCACTCGAGTGAGGGTACTTTAGATACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-315s1c1
Sequence:CCGGCCAATATGAACACTTCCGAAACTCGAGTTTCGGAAGTGTTCATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-153s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_016060.1-286s1c1
Sequence:CCGGCCTCAGTGTTTACACATGTTACTCGAGTAACATGTGTAAACACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-127s1c1
Sequence:CCGGCGGTTTCAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGAAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-259s1c1
Sequence:CCGGCCAGAATATGCCAAGTATCTACTCGAGTAGATACTTGGCATATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-166s21c1
Sequence:CCGGGGAGTTGGAATTTGTGCAATGCTCGAGCATTGCACAAATTCCAACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-134s21c1
Sequence:CCGGGATGATGCTGGAAATCGACTTCTCGAGAAGTCGATTTCCAGCATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-329s21c1
Sequence:CCGGATGTTAGAGCTGCTCCAATATCTCGAGATATTGGAGCAGCTCTAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016060
VALIDATED
MED31 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-219s21c1
Sequence:CCGGCCCAAAGAGGTTACTTCAAAGCTCGAGCTTTGAAGTAACCTCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-298s21c1
Sequence:CCGGCAAGTATCTAAAGTACCCTCACTCGAGTGAGGGTACTTTAGATACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-315s1c1
Sequence:CCGGCCAATATGAACACTTCCGAAACTCGAGTTTCGGAAGTGTTCATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-153s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_016060.1-286s1c1
Sequence:CCGGCCTCAGTGTTTACACATGTTACTCGAGTAACATGTGTAAACACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-127s1c1
Sequence:CCGGCGGTTTCAGTTGGAGTTGGAACTCGAGTTCCAACTCCAACTGAAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016060.1-259s1c1
Sequence:CCGGCCAGAATATGCCAAGTATCTACTCGAGTAGATACTTGGCATATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-166s21c1
Sequence:CCGGGGAGTTGGAATTTGTGCAATGCTCGAGCATTGCACAAATTCCAACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-134s21c1
Sequence:CCGGGATGATGCTGGAAATCGACTTCTCGAGAAGTCGATTTCCAGCATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016060.2-329s21c1
Sequence:CCGGATGTTAGAGCTGCTCCAATATCTCGAGATATTGGAGCAGCTCTAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026068
VALIDATED
MED31 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 31
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-772s21c1
Sequence:CCGGTTACTGGAAAGAACCAGAATACTCGAGTATTCTGGTTCTTTCCAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-235s1c1
Sequence:CCGGGCCAAATATCTAAAGTACCCTCTCGAGAGGGTACTTTAGATATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-120s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-130s1c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-157s1c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-223s1c1
Sequence:CCGGGAACCAGAATATGCCAAATATCTCGAGATATTTGGCATATTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-716s21c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-828s21c1
Sequence:CCGGTGTTAGAGCTGCTCCAGTATGCTCGAGCATACTGGAGCAGCTCTAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-249s1c1
Sequence:CCGGGTACCCTCAGTGCTTACATATCTCGAGATATGTAAGCACTGAGGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-226s1c1
Sequence:CCGGCCAGAATATGCCAAATATCTACTCGAGTAGATATTTGGCATATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-855s21c1
Sequence:CCGGTTCGCAAGGAGCTGGTGAATGCTCGAGCATTCACCAGCTCCTTGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-277s1c1
Sequence:CCGGCTGCTCCAGTATGAGCACTTTCTCGAGAAAGTGCTCATACTGGAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-689s21c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-417s1c1
Sequence:CCGGGCAGAATAACACAGCAGGGAACTCGAGTTCCCTGCTGTGTTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026068
VALIDATED
MED31 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 31
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-772s21c1
Sequence:CCGGTTACTGGAAAGAACCAGAATACTCGAGTATTCTGGTTCTTTCCAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-235s1c1
Sequence:CCGGGCCAAATATCTAAAGTACCCTCTCGAGAGGGTACTTTAGATATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-120s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-130s1c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-157s1c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-223s1c1
Sequence:CCGGGAACCAGAATATGCCAAATATCTCGAGATATTTGGCATATTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-716s21c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-828s21c1
Sequence:CCGGTGTTAGAGCTGCTCCAGTATGCTCGAGCATACTGGAGCAGCTCTAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-249s1c1
Sequence:CCGGGTACCCTCAGTGCTTACATATCTCGAGATATGTAAGCACTGAGGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-226s1c1
Sequence:CCGGCCAGAATATGCCAAATATCTACTCGAGTAGATATTTGGCATATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-855s21c1
Sequence:CCGGTTCGCAAGGAGCTGGTGAATGCTCGAGCATTCACCAGCTCCTTGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-277s1c1
Sequence:CCGGCTGCTCCAGTATGAGCACTTTCTCGAGAAAGTGCTCATACTGGAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-689s21c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-417s1c1
Sequence:CCGGGCAGAATAACACAGCAGGGAACTCGAGTTCCCTGCTGTGTTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026068
VALIDATED
MED31 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 31
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-772s21c1
Sequence:CCGGTTACTGGAAAGAACCAGAATACTCGAGTATTCTGGTTCTTTCCAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-235s1c1
Sequence:CCGGGCCAAATATCTAAAGTACCCTCTCGAGAGGGTACTTTAGATATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-120s1c1
Sequence:CCGGGCAATGTTTAGCCAACCCAAACTCGAGTTTGGGTTGGCTAAACATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-130s1c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026068.1-157s1c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-223s1c1
Sequence:CCGGGAACCAGAATATGCCAAATATCTCGAGATATTTGGCATATTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-716s21c1
Sequence:CCGGGCCCAAAGAGGTTACTTCAAACTCGAGTTTGAAGTAACCTCTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-828s21c1
Sequence:CCGGTGTTAGAGCTGCTCCAGTATGCTCGAGCATACTGGAGCAGCTCTAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-249s1c1
Sequence:CCGGGTACCCTCAGTGCTTACATATCTCGAGATATGTAAGCACTGAGGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-226s1c1
Sequence:CCGGCCAGAATATGCCAAATATCTACTCGAGTAGATATTTGGCATATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-855s21c1
Sequence:CCGGTTCGCAAGGAGCTGGTGAATGCTCGAGCATTCACCAGCTCCTTGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-277s1c1
Sequence:CCGGCTGCTCCAGTATGAGCACTTTCTCGAGAAAGTGCTCATACTGGAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026068.2-689s21c1
Sequence:CCGGGCCAACCCAAACTACCTTAATCTCGAGATTAAGGTAGTTTGGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026068.1-417s1c1
Sequence:CCGGGCAGAATAACACAGCAGGGAACTCGAGTTCCCTGCTGTGTTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)