EMAIL THIS PAGE TO A FRIEND

MED4

mediator complex subunit 4

55 Gene Product Result for
Synonyms: ARC36 DRIP36 HSPC126 TRAP36 VDRIP
Gene ID:
Human(29079) Summary: This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Mouse(67381) mediator of RNA polymerase II transcription, subunit 4 homolog (yeast)
Rat(306030) mediator complex subunit 4
Zebrafish(550582) mediator complex subunit 4
chicken(418859) mediator complex subunit 4
cow(515299) mediator complex subunit 4
domestic cat(101095871) mediator complex subunit 4
fruit fly(38799) Mediator complex subunit 4
sheep(101113861) mediator complex subunit 4
naked mole-rat(101704780) mediator complex subunit 4
domestic guinea pig(100718343) mediator complex subunit 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV50561 Anti-MED4 (AB1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, human, rabbit, rat, bovine, dog, horse
immunohistochemistry, western blot pricing
AV50562 Anti-MED4 (AB2) antibody produced in rabbit affinity isolated antibody horse, bovine, dog, guinea pig, rabbit, human, rat, mouse
immunohistochemistry, western blot pricing
HPA006232 Anti-MED4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500264 Anti-MED4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1402571 Monoclonal Anti-MED4 antibody produced in mouse clone 2B10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014166 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014166 Rosetta Predictions human pricing
NM_001024256 Rosetta Predictions rat pricing
NM_026119 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146127 predicted 930
2 SASI_Hs01_00146128 predicted 871
3 SASI_Hs01_00146129 predicted 673
4 SASI_Hs01_00146130 predicted 905
5 SASI_Hs01_00146131 predicted 856
6 SASI_Hs01_00146132 predicted 608
7 SASI_Hs01_00146133 predicted 821
8 SASI_Hs02_00345159 predicted 928
9 SASI_Hs02_00345160 predicted 859
10 SASI_Hs02_00345161 predicted 724
11 SASI_Hs01_00146126 predicted 250
12 SASI_Hs01_00146134 predicted 682
13 SASI_Hs01_00146135 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099229 predicted 373
2 SASI_Rn01_00099230 predicted 897
3 SASI_Rn01_00099231 predicted 309
4 SASI_Rn01_00099232 predicted 238
5 SASI_Rn01_00099233 predicted 441
6 SASI_Rn01_00099234 predicted 228
7 SASI_Rn01_00099235 predicted 477
8 SASI_Rn01_00099236 predicted 404
9 SASI_Rn01_00099237 predicted 279
10 SASI_Rn01_00099238 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329696 predicted 427
2 SASI_Mm01_00041214 predicted 378
3 SASI_Mm01_00041215 predicted 239
4 SASI_Mm01_00041217 predicted 775
5 SASI_Mm01_00041218 predicted 440
6 SASI_Mm01_00041219 predicted 231
7 SASI_Mm01_00041220 predicted 402
8 SASI_Mm01_00041221 predicted 560
9 SASI_Mm02_00329697 predicted 565
10 SASI_Mm01_00041222 predicted 884
11 SASI_Mm01_00041216 predicted 386
12 SASI_Mm01_00041223 predicted 473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026119
VALIDATED
MED4 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-990s21c1
Sequence:CCGGGTAGTGTTTGGTTGTACATAGCTCGAGCTATGTACAACCAAACACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-1044s21c1
Sequence:CCGGCAACTCATGGAGCATACTTAGCTCGAGCTAAGTATGCTCCATGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-128s21c1
Sequence:CCGGTCTTGTCGAGGGAACTCATAGCTCGAGCTATGAGTTCCCTCGACAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-766s21c1
Sequence:CCGGGAAGATGATGTTGAGGTTATGCTCGAGCATAACCTCAACATCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026119.2-1176s1c1
Sequence:CCGGCCAGGGTAACAGAGATAAGAACTCGAGTTCTTATCTCTGTTACCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-153s1c1
Sequence:CCGGGCTTGCAATTTCAAGAAATCACTCGAGTGATTTCTTGAAATTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-211s1c1
Sequence:CCGGGAGTTGCTAATTCACCGAGATCTCGAGATCTCGGTGAATTAGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-967s21c1
Sequence:CCGGTTTGAGGATTAGTCAGAATTACTCGAGTAATTCTGACTAATCCTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026119
VALIDATED
MED4 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-990s21c1
Sequence:CCGGGTAGTGTTTGGTTGTACATAGCTCGAGCTATGTACAACCAAACACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-1044s21c1
Sequence:CCGGCAACTCATGGAGCATACTTAGCTCGAGCTAAGTATGCTCCATGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-128s21c1
Sequence:CCGGTCTTGTCGAGGGAACTCATAGCTCGAGCTATGAGTTCCCTCGACAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-766s21c1
Sequence:CCGGGAAGATGATGTTGAGGTTATGCTCGAGCATAACCTCAACATCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026119.2-1176s1c1
Sequence:CCGGCCAGGGTAACAGAGATAAGAACTCGAGTTCTTATCTCTGTTACCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-153s1c1
Sequence:CCGGGCTTGCAATTTCAAGAAATCACTCGAGTGATTTCTTGAAATTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-211s1c1
Sequence:CCGGGAGTTGCTAATTCACCGAGATCTCGAGATCTCGGTGAATTAGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-967s21c1
Sequence:CCGGTTTGAGGATTAGTCAGAATTACTCGAGTAATTCTGACTAATCCTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026119
VALIDATED
MED4 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345902    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-990s21c1
Sequence:CCGGGTAGTGTTTGGTTGTACATAGCTCGAGCTATGTACAACCAAACACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-1044s21c1
Sequence:CCGGCAACTCATGGAGCATACTTAGCTCGAGCTAAGTATGCTCCATGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-128s21c1
Sequence:CCGGTCTTGTCGAGGGAACTCATAGCTCGAGCTATGAGTTCCCTCGACAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-766s21c1
Sequence:CCGGGAAGATGATGTTGAGGTTATGCTCGAGCATAACCTCAACATCATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026119.2-1176s1c1
Sequence:CCGGCCAGGGTAACAGAGATAAGAACTCGAGTTCTTATCTCTGTTACCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-153s1c1
Sequence:CCGGGCTTGCAATTTCAAGAAATCACTCGAGTGATTTCTTGAAATTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026119.2-211s1c1
Sequence:CCGGGAGTTGCTAATTCACCGAGATCTCGAGATCTCGGTGAATTAGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026119.3-967s21c1
Sequence:CCGGTTTGAGGATTAGTCAGAATTACTCGAGTAATTCTGACTAATCCTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014166
VALIDATED
MED4 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-751s21c1
Sequence:CCGGTGGAACCTCCTGGGCATAATACTCGAGTATTATGCCCAGGAGGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-1157s21c1
Sequence:CCGGTCGAGGGAAATTATCCATATACTCGAGTATATGGATAATTTCCCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-726s1c1
Sequence:CCGGCCAAATCATAGTAGTGACTTTCTCGAGAAAGTCACTACTATGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-169s1c1
Sequence:CCGGTGGCAATTTCAAGAAACCAAACTCGAGTTTGGTTTCTTGAAATTGCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-709s1c1
Sequence:CCGGCGATGAATATGTTACCACCAACTCGAGTTGGTGGTAACATATTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-225s1c1
Sequence:CCGGGAGTTGTTAATTCACCGAGATCTCGAGATCTCGGTGAATTAACAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-593s1c1
Sequence:CCGGGATGAACAATCCTTCCACTAACTCGAGTTAGTGGAAGGATTGTTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-547s21c1
Sequence:CCGGGACCCTACCCAACTGATTTAGCTCGAGCTAAATCAGTTGGGTAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-681s21c1
Sequence:CCGGCAGTATCCATGGCAGTCAAATCTCGAGATTTGACTGCCATGGATACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-483s21c1
Sequence:CCGGCATAGGATCAGTGCAAGTAATCTCGAGATTACTTGCACTGATCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014166
VALIDATED
MED4 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-751s21c1
Sequence:CCGGTGGAACCTCCTGGGCATAATACTCGAGTATTATGCCCAGGAGGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-1157s21c1
Sequence:CCGGTCGAGGGAAATTATCCATATACTCGAGTATATGGATAATTTCCCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-726s1c1
Sequence:CCGGCCAAATCATAGTAGTGACTTTCTCGAGAAAGTCACTACTATGATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-169s1c1
Sequence:CCGGTGGCAATTTCAAGAAACCAAACTCGAGTTTGGTTTCTTGAAATTGCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-709s1c1
Sequence:CCGGCGATGAATATGTTACCACCAACTCGAGTTGGTGGTAACATATTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-225s1c1
Sequence:CCGGGAGTTGTTAATTCACCGAGATCTCGAGATCTCGGTGAATTAACAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-593s1c1
Sequence:CCGGGATGAACAATCCTTCCACTAACTCGAGTTAGTGGAAGGATTGTTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-547s21c1
Sequence:CCGGGACCCTACCCAACTGATTTAGCTCGAGCTAAATCAGTTGGGTAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-681s21c1
Sequence:CCGGCAGTATCCATGGCAGTCAAATCTCGAGATTTGACTGCCATGGATACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-483s21c1
Sequence:CCGGCATAGGATCAGTGCAAGTAATCTCGAGATTACTTGCACTGATCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014166
VALIDATED
MED4 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-751s21c1
Sequence:CCGGTGGAACCTCCTGGGCATAATACTCGAGTATTATGCCCAGGAGGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330869    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-1157s21c1
Sequence:CCGGTCGAGGGAAATTATCCATATACTCGAGTATATGGATAATTTCCCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-726s1c1
Sequence:CCGGCCAAATCATAGTAGTGACTTTCTCGAGAAAGTCACTACTATGATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-169s1c1
Sequence:CCGGTGGCAATTTCAAGAAACCAAACTCGAGTTTGGTTTCTTGAAATTGCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-709s1c1
Sequence:CCGGCGATGAATATGTTACCACCAACTCGAGTTGGTGGTAACATATTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_014166.2-225s1c1
Sequence:CCGGGAGTTGTTAATTCACCGAGATCTCGAGATCTCGGTGAATTAACAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014166.2-593s1c1
Sequence:CCGGGATGAACAATCCTTCCACTAACTCGAGTTAGTGGAAGGATTGTTCATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-547s21c1
Sequence:CCGGGACCCTACCCAACTGATTTAGCTCGAGCTAAATCAGTTGGGTAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-681s21c1
Sequence:CCGGCAGTATCCATGGCAGTCAAATCTCGAGATTTGACTGCCATGGATACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014166.2-483s21c1
Sequence:CCGGCATAGGATCAGTGCAAGTAATCTCGAGATTACTTGCACTGATCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)