EMAIL THIS PAGE TO A FRIEND

MED7

mediator complex subunit 7

85 Gene Product Result for
Synonyms: ARC34 CRSP33 CRSP9
UniProtKB ID: O43513
Gene ID:
Human(9443) Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(66213) mediator complex subunit 7
Rat(100911235) mediator complex subunit 7
Zebrafish(326098) mediator complex subunit 7
cow(509729) mediator complex subunit 7
Horse(100629872) mediator of RNA polymerase II transcription subunit 7
domestic cat(101100364) mediator complex subunit 7
dog(100688348) mediator complex subunit 7
chicken(100857575) mediator complex subunit 7
fruit fly(41288) Mediator complex subunit 7
sheep(101112394) mediator complex subunit 7
naked mole-rat(101711948) mediator complex subunit 7
domestic guinea pig(100720988) mediator complex subunit 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100816 Rosetta Predictions human pricing
NM_004270 Rosetta Predictions human pricing
NM_001104530 Rosetta Predictions mouse pricing
NM_001104556 Rosetta Predictions mouse pricing
NM_001104557 Rosetta Predictions mouse pricing
NM_025426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322357 predicted 780
2 SASI_Hs02_00322358 predicted 582
3 SASI_Hs02_00322359 predicted 583
4 SASI_Hs02_00322360 predicted 738
5 SASI_Hs02_00322361 predicted 866
6 SASI_Hs02_00322362 predicted 808
7 SASI_Hs02_00322363 predicted 573
8 SASI_Hs02_00322364 predicted 821
9 SASI_Hs02_00322365 predicted 709
10 SASI_Hs02_00322366 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184116 predicted 501
2 SASI_Hs02_00337245 predicted 298
3 SASI_Hs02_00337246 predicted 295
4 SASI_Hs01_00184119 predicted 453
5 SASI_Hs01_00184120 predicted 578
6 SASI_Hs01_00184121 predicted 525
7 SASI_Hs01_00184122 predicted 287
8 SASI_Hs01_00184124 predicted 543
9 SASI_Hs01_00184125 predicted 420
10 SASI_Hs02_00337247 predicted 576
11 SASI_Hs01_00184117 predicted 459
12 SASI_Hs01_00184118 predicted 204
13 SASI_Hs01_00184123 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303276 predicted 487
2 SASI_Mm02_00303277 predicted 722
3 SASI_Mm02_00303278 predicted 652
4 SASI_Mm02_00303279 predicted 773
5 SASI_Mm02_00303280 predicted 431
6 SASI_Mm02_00303281 predicted 446
7 SASI_Mm02_00303282 predicted 797
8 SASI_Mm02_00303283 predicted 918
9 SASI_Mm02_00303284 predicted 504
10 SASI_Mm02_00303285 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303364 predicted 482
2 SASI_Mm02_00303365 predicted 723
3 SASI_Mm02_00303366 predicted 653
4 SASI_Mm02_00303367 predicted 773
5 SASI_Mm02_00303368 predicted 433
6 SASI_Mm02_00303369 predicted 451
7 SASI_Mm02_00303370 predicted 788
8 SASI_Mm02_00303371 predicted 910
9 SASI_Mm02_00303372 predicted 502
10 SASI_Mm02_00303373 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303374 predicted 315
2 SASI_Mm02_00303375 predicted 557
3 SASI_Mm02_00303376 predicted 484
4 SASI_Mm02_00303377 predicted 608
5 SASI_Mm02_00303378 predicted 259
6 SASI_Mm02_00303379 predicted 278
7 SASI_Mm02_00303380 predicted 622
8 SASI_Mm02_00303381 predicted 744
9 SASI_Mm02_00303382 predicted 333
10 SASI_Mm02_00303383 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101122 predicted 655
2 SASI_Mm02_00328223 predicted 894
3 SASI_Mm01_00101124 predicted 825
4 SASI_Mm01_00101125 predicted 942
5 SASI_Mm02_00328224 predicted 600
6 SASI_Mm02_00328225 predicted 617
7 SASI_Mm02_00328226 predicted 960
8 SASI_Mm01_00101118 predicted 1079
9 SASI_Mm02_00328227 predicted 672
10 SASI_Mm02_00328228 predicted 818
11 SASI_Mm01_00101116 predicted 1094
12 SASI_Mm01_00101117 predicted 1001
13 SASI_Mm01_00101119 predicted 1064
14 SASI_Mm01_00101120 predicted 1016
15 SASI_Mm01_00101121 predicted 1131
16 SASI_Mm01_00101123 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025426
VALIDATED
MED7 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 7
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-1254s1c1
Sequence:CCGGCCAGCAAGTATATTTGAGTAACTCGAGTTACTCAAATATACTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-441s1c1
Sequence:CCGGGCCTCCAATGCAGTACATCAACTCGAGTTGATGTACTGCATTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-553s1c1
Sequence:CCGGCGATGTGATGATCTTATCATTCTCGAGAATGATAAGATCATCACATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-561s1c1
Sequence:CCGGTGATCTTATCATTCGCCCTTTCTCGAGAAAGGGCGAATGATAAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-514s21c1
Sequence:CCGGCAAGCCTCCTCCTCCAATTAACTCGAGTTAATTGGAGGAGGAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-979s21c1
Sequence:CCGGGCCGATGGATACTGATGATAACTCGAGTTATCATCAGTATCCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025426.3-1395s21c1
Sequence:CCGGTATTTGCTTCGAGACTAATAACTCGAGTTATTAGTCTCGAAGCAAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-623s21c1
Sequence:CCGGCCTATGCAATTTGATCATAAGCTCGAGCTTATGATCAAATTGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1046s21c1
Sequence:CCGGCACAGAAGGGACCAGATTATACTCGAGTATAATCTGGTCCCTTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-575s21c1
Sequence:CCGGGATCTTATCATTCGCCCTTTACTCGAGTAAAGGGCGAATGATAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-922s21c1
Sequence:CCGGGGCTTCTTTGCCCGATGATTTCTCGAGAAATCATCGGGCAAAGAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1184s21c1
Sequence:CCGGGTCTTAAGAGGTATAACTAAACTCGAGTTTAGTTATACCTCTTAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025426
VALIDATED
MED7 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 7
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-1254s1c1
Sequence:CCGGCCAGCAAGTATATTTGAGTAACTCGAGTTACTCAAATATACTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-441s1c1
Sequence:CCGGGCCTCCAATGCAGTACATCAACTCGAGTTGATGTACTGCATTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-553s1c1
Sequence:CCGGCGATGTGATGATCTTATCATTCTCGAGAATGATAAGATCATCACATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-561s1c1
Sequence:CCGGTGATCTTATCATTCGCCCTTTCTCGAGAAAGGGCGAATGATAAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-514s21c1
Sequence:CCGGCAAGCCTCCTCCTCCAATTAACTCGAGTTAATTGGAGGAGGAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-979s21c1
Sequence:CCGGGCCGATGGATACTGATGATAACTCGAGTTATCATCAGTATCCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025426.3-1395s21c1
Sequence:CCGGTATTTGCTTCGAGACTAATAACTCGAGTTATTAGTCTCGAAGCAAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-623s21c1
Sequence:CCGGCCTATGCAATTTGATCATAAGCTCGAGCTTATGATCAAATTGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1046s21c1
Sequence:CCGGCACAGAAGGGACCAGATTATACTCGAGTATAATCTGGTCCCTTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-575s21c1
Sequence:CCGGGATCTTATCATTCGCCCTTTACTCGAGTAAAGGGCGAATGATAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-922s21c1
Sequence:CCGGGGCTTCTTTGCCCGATGATTTCTCGAGAAATCATCGGGCAAAGAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1184s21c1
Sequence:CCGGGTCTTAAGAGGTATAACTAAACTCGAGTTTAGTTATACCTCTTAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025426
VALIDATED
MED7 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 7
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-1254s1c1
Sequence:CCGGCCAGCAAGTATATTTGAGTAACTCGAGTTACTCAAATATACTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-441s1c1
Sequence:CCGGGCCTCCAATGCAGTACATCAACTCGAGTTGATGTACTGCATTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025426.2-553s1c1
Sequence:CCGGCGATGTGATGATCTTATCATTCTCGAGAATGATAAGATCATCACATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025426.2-561s1c1
Sequence:CCGGTGATCTTATCATTCGCCCTTTCTCGAGAAAGGGCGAATGATAAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-514s21c1
Sequence:CCGGCAAGCCTCCTCCTCCAATTAACTCGAGTTAATTGGAGGAGGAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-979s21c1
Sequence:CCGGGCCGATGGATACTGATGATAACTCGAGTTATCATCAGTATCCATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366452    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025426.3-1395s21c1
Sequence:CCGGTATTTGCTTCGAGACTAATAACTCGAGTTATTAGTCTCGAAGCAAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025426.3-623s21c1
Sequence:CCGGCCTATGCAATTTGATCATAAGCTCGAGCTTATGATCAAATTGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1046s21c1
Sequence:CCGGCACAGAAGGGACCAGATTATACTCGAGTATAATCTGGTCCCTTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-575s21c1
Sequence:CCGGGATCTTATCATTCGCCCTTTACTCGAGTAAAGGGCGAATGATAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-922s21c1
Sequence:CCGGGGCTTCTTTGCCCGATGATTTCTCGAGAAATCATCGGGCAAAGAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375086    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025426.3-1184s21c1
Sequence:CCGGGTCTTAAGAGGTATAACTAAACTCGAGTTTAGTTATACCTCTTAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004270
VALIDATED
MED7 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-723s1c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-258s1c1
Sequence:CCGGCGGCTTCATCCTATGCAGTTTCTCGAGAAACTGCATAGGATGAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-102s1c1
Sequence:CCGGCCAATGCAATATATCAAGGAACTCGAGTTCCTTGATATATTGCATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-209s1c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-660s1c1
Sequence:CCGGCAGAATGAACATCAAAGAGAACTCGAGTTCTCTTTGATGTTCATTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-458s21c1
Sequence:CCGGTACACGTGCATCATCTTATAACTCGAGTTATAAGATGATGCACGTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-255s21c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004270.4-572s21c1
Sequence:CCGGAGCACCTGGAACGAGTAATTGCTCGAGCAATTACTCGTTCCAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-945s21c1
Sequence:CCGGAGATGTCATAGGCAGTAATTTCTCGAGAAATTACTGCCTATGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-769s21c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004270
VALIDATED
MED7 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-723s1c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-258s1c1
Sequence:CCGGCGGCTTCATCCTATGCAGTTTCTCGAGAAACTGCATAGGATGAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-102s1c1
Sequence:CCGGCCAATGCAATATATCAAGGAACTCGAGTTCCTTGATATATTGCATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-209s1c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-660s1c1
Sequence:CCGGCAGAATGAACATCAAAGAGAACTCGAGTTCTCTTTGATGTTCATTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-458s21c1
Sequence:CCGGTACACGTGCATCATCTTATAACTCGAGTTATAAGATGATGCACGTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-255s21c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004270.4-572s21c1
Sequence:CCGGAGCACCTGGAACGAGTAATTGCTCGAGCAATTACTCGTTCCAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-945s21c1
Sequence:CCGGAGATGTCATAGGCAGTAATTTCTCGAGAAATTACTGCCTATGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-769s21c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004270
VALIDATED
MED7 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-723s1c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-258s1c1
Sequence:CCGGCGGCTTCATCCTATGCAGTTTCTCGAGAAACTGCATAGGATGAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-102s1c1
Sequence:CCGGCCAATGCAATATATCAAGGAACTCGAGTTCCTTGATATATTGCATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004270.3-209s1c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004270.3-660s1c1
Sequence:CCGGCAGAATGAACATCAAAGAGAACTCGAGTTCTCTTTGATGTTCATTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-458s21c1
Sequence:CCGGTACACGTGCATCATCTTATAACTCGAGTTATAAGATGATGCACGTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-255s21c1
Sequence:CCGGCCAATGTGATGATCTTATCATCTCGAGATGATAAGATCATCACATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004270.4-572s21c1
Sequence:CCGGAGCACCTGGAACGAGTAATTGCTCGAGCAATTACTCGTTCCAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331032    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-945s21c1
Sequence:CCGGAGATGTCATAGGCAGTAATTTCTCGAGAAATTACTGCCTATGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004270.4-769s21c1
Sequence:CCGGGCCTTGTGTGTCCTAATTGATCTCGAGATCAATTAGGACACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)