EMAIL THIS PAGE TO A FRIEND

MED8

mediator complex subunit 8

136 Gene Product Result for
Synonyms: ARC32
UniProtKB ID: Q96G25, A9IZ91, A9IZ92, Q5JUY8, Q96FQ4
Gene ID:
Human(112950) Summary: This gene encodes a protein component of the mediator complex, which aids in transcriptional activation through interaction with RNA polymerase II and gene-specific transcription factors. The encoded protein may also function in ubiquitin ligation and protein degradation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Mouse(80509) mediator of RNA polymerase II transcription, subunit 8 homolog (yeast)
Rat(362575) mediator complex subunit 8
domestic guinea pig(100719093) mediator complex subunit 8
naked mole-rat(101707961) mediator complex subunit 8
sheep(101107155) mediator complex subunit 8
Zebrafish(404615) mediator complex subunit 8
Thale Cress(814836) mediator subunit 8
chicken(424565) mediator complex subunit 8
cow(507623) mediator complex subunit 8
domestic cat(101098070) mediator complex subunit 8
dog(610777) mediator complex subunit 8
fruit fly(37305) Mediator complex subunit 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020000 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020000 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020000 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001651 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001651 Rosetta Predictions human pricing
NM_001001653 Rosetta Predictions human pricing
NM_001001654 Rosetta Predictions human pricing
NM_052877 Rosetta Predictions human pricing
NM_201542 Rosetta Predictions human pricing
NM_001108673 Rosetta Predictions rat pricing
NM_020000 Rosetta Predictions mouse pricing
NM_173719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142024 predicted 525
2 SASI_Hs01_00142025 predicted 617
3 SASI_Hs01_00142026 predicted 508
4 SASI_Hs01_00142027 predicted 462
5 SASI_Hs01_00142028 predicted 427
6 SASI_Hs01_00142029 predicted 546
7 SASI_Hs01_00142030 predicted 431
8 SASI_Hs01_00142031 predicted 629
9 SASI_Hs01_00142032 predicted 607
10 SASI_Hs01_00142033 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061422 predicted 561
2 SASI_Hs01_00061423 predicted 658
3 SASI_Hs01_00061424 predicted 560
4 SASI_Hs01_00061425 predicted 505
5 SASI_Hs01_00061426 predicted 469
6 SASI_Hs01_00061427 predicted 595
7 SASI_Hs01_00061428 predicted 482
8 SASI_Hs01_00061429 predicted 673
9 SASI_Hs01_00061430 predicted 648
10 SASI_Hs01_00061431 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178157 predicted 525
2 SASI_Hs01_00178158 predicted 614
3 SASI_Hs01_00178159 predicted 508
4 SASI_Hs01_00178160 predicted 467
5 SASI_Hs01_00178161 predicted 420
6 SASI_Hs01_00178162 predicted 546
7 SASI_Hs01_00178163 predicted 430
8 SASI_Hs01_00178164 predicted 629
9 SASI_Hs01_00178165 predicted 603
10 SASI_Hs01_00178166 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124866 predicted 519
2 SASI_Hs01_00124868 predicted 507
3 SASI_Hs01_00124869 predicted 456
4 SASI_Hs01_00124870 predicted 421
5 SASI_Hs02_00361587 predicted 320
6 SASI_Hs02_00361588 predicted 355
7 SASI_Hs01_00124871 predicted 547
8 SASI_Hs01_00124872 predicted 427
9 SASI_Hs02_00361589 predicted 353
10 SASI_Hs01_00124874 predicted 597
11 SASI_Hs01_00124867 predicted 679
12 SASI_Hs01_00124873 predicted 697
13 SASI_Hs01_00124875 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141478 predicted 517
2 SASI_Hs01_00141480 predicted 511
3 SASI_Hs01_00141481 predicted 464
4 SASI_Hs01_00141482 predicted 413
5 SASI_Hs02_00373021 predicted 322
6 SASI_Hs02_00373022 predicted 363
7 SASI_Hs01_00141483 predicted 550
8 SASI_Hs01_00141484 predicted 426
9 SASI_Hs02_00373023 predicted 350
10 SASI_Hs01_00141486 predicted 601
11 SASI_Hs01_00141479 predicted 667
12 SASI_Hs01_00141485 predicted 676
13 SASI_Hs01_00141487 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240945 predicted 246
2 SASI_Rn02_00240946 predicted 289
3 SASI_Rn02_00240947 predicted 358
4 SASI_Rn02_00240948 predicted 225
5 SASI_Rn02_00240949 predicted 286
6 SASI_Rn02_00240950 predicted 290
7 SASI_Rn02_00240951 predicted 360
8 SASI_Rn02_00240952 predicted 322
9 SASI_Rn02_00240953 predicted 395
10 SASI_Rn02_00240954 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020000 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325348 predicted 1202
2 SASI_Mm02_00325349 predicted 1187
3 SASI_Mm02_00325350 predicted 986
4 SASI_Mm02_00325351 predicted 1122
5 SASI_Mm02_00325352 predicted 1010
6 SASI_Mm02_00325353 predicted 1031
7 SASI_Mm02_00325354 predicted 1141
8 SASI_Mm02_00325355 predicted 1255
9 SASI_Mm02_00325356 predicted 1031
10 SASI_Mm02_00325357 predicted 1186
11 SASI_Mm01_00176466 predicted 2365
12 SASI_Mm01_00176467 predicted 2033
13 SASI_Mm01_00176468 predicted 2186
14 SASI_Mm01_00176469 predicted 2096
15 SASI_Mm01_00176470 predicted 1515
16 SASI_Mm01_00176471 predicted 1842
17 SASI_Mm01_00176472 predicted 1950
18 SASI_Mm01_00176473 predicted 1707
19 SASI_Mm01_00176474 predicted 1997
20 SASI_Mm01_00176475 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345363 predicted 1107
2 SASI_Mm02_00345364 predicted 1086
3 SASI_Mm02_00345365 predicted 890
4 SASI_Mm02_00345366 predicted 1022
5 SASI_Mm02_00345367 predicted 915
6 SASI_Mm02_00345368 predicted 931
7 SASI_Mm02_00345369 predicted 1032
8 SASI_Mm02_00345370 predicted 1150
9 SASI_Mm02_00345371 predicted 932
10 SASI_Mm02_00345372 predicted 1079
11 SASI_Mm01_00075331 predicted 754
12 SASI_Mm01_00075332 predicted 580
13 SASI_Mm01_00075333 predicted 382
14 SASI_Mm01_00075334 predicted 495
15 SASI_Mm01_00075335 predicted 251
16 SASI_Mm01_00075336 predicted 341
17 SASI_Mm01_00075337 predicted 537
18 SASI_Mm01_00075338 predicted 242
19 SASI_Mm01_00075339 predicted 569
20 SASI_Mm01_00075340 predicted 730
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052877
VALIDATED
MED8 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 8
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-219s21c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052877.3-1003s21c1
Sequence:CCGGTTACCTGTCAAATAGTCATAACTCGAGTTATGACTATTTGACAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-409s21c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-549s21c1
Sequence:CCGGGCCGAACAAGCAGACCTTTAACTCGAGTTAAAGGTCTGCTTGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052877.3-260s21c1
Sequence:CCGGTCCGTAACCAGGTCATCATTCCTCGAGGAATGATGACCTGGTTACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052877
VALIDATED
MED8 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 8
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-219s21c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052877.3-1003s21c1
Sequence:CCGGTTACCTGTCAAATAGTCATAACTCGAGTTATGACTATTTGACAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-409s21c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-549s21c1
Sequence:CCGGGCCGAACAAGCAGACCTTTAACTCGAGTTAAAGGTCTGCTTGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052877.3-260s21c1
Sequence:CCGGTCCGTAACCAGGTCATCATTCCTCGAGGAATGATGACCTGGTTACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052877
VALIDATED
MED8 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 8
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-219s21c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052877.3-1003s21c1
Sequence:CCGGTTACCTGTCAAATAGTCATAACTCGAGTTATGACTATTTGACAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-409s21c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_052877.3-549s21c1
Sequence:CCGGGCCGAACAAGCAGACCTTTAACTCGAGTTAAAGGTCTGCTTGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052877.3-260s21c1
Sequence:CCGGTCCGTAACCAGGTCATCATTCCTCGAGGAATGATGACCTGGTTACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020000
VALIDATED
MED8 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-92s21c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020000.2-890s21c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-224s21c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-125s21c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-302s21c1
Sequence:CCGGCGAAGACCTCATGCGTCAAACCTCGAGGTTTGACGCATGAGGTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020000.1-2101s1c2
Sequence:CCGGCTATCTAATTGGCGACCTTCACTCGAGTGAAGGTCGCCAATTAGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1581s1c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1710s1c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-2376s1c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1548s1c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020000
VALIDATED
MED8 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-92s21c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020000.2-890s21c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-224s21c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-125s21c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-302s21c1
Sequence:CCGGCGAAGACCTCATGCGTCAAACCTCGAGGTTTGACGCATGAGGTCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020000.1-2101s1c2
Sequence:CCGGCTATCTAATTGGCGACCTTCACTCGAGTGAAGGTCGCCAATTAGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1581s1c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1710s1c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-2376s1c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1548s1c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020000
VALIDATED
MED8 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-92s21c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020000.2-890s21c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-224s21c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020000.2-125s21c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020000.2-302s21c1
Sequence:CCGGCGAAGACCTCATGCGTCAAACCTCGAGGTTTGACGCATGAGGTCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020000.1-2101s1c2
Sequence:CCGGCTATCTAATTGGCGACCTTCACTCGAGTGAAGGTCGCCAATTAGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1581s1c1
Sequence:CCGGGAGTTTCATTTACAAGTTGGACTCGAGTCCAACTTGTAAATGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1710s1c1
Sequence:CCGGCAAGGTCTTAAAGCATGAGAACTCGAGTTCTCATGCTTTAAGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-2376s1c1
Sequence:CCGGGAGTTGAGCAATGACATGATTCTCGAGAATCATGTCATTGCTCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020000.1-1548s1c1
Sequence:CCGGGAATCAAGTGGCCGATCTGAACTCGAGTTCAGATCGGCCACTTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001651
VALIDATED
MED8 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001651.1-1137s1c1
Sequence:CCGGCCCTGGATTCATGTTTCTTATCTCGAGATAAGAAACATGAATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-409s1c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-219s1c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001651.1-605s1c1
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-861s1c1
Sequence:CCGGCCTGGGTTTCATTCTGGCTATCTCGAGATAGCCAGAATGAAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-605s1c2
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001651
VALIDATED
MED8 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001651.1-1137s1c1
Sequence:CCGGCCCTGGATTCATGTTTCTTATCTCGAGATAAGAAACATGAATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-409s1c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-219s1c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001651.1-605s1c1
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-861s1c1
Sequence:CCGGCCTGGGTTTCATTCTGGCTATCTCGAGATAGCCAGAATGAAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-605s1c2
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001651
VALIDATED
MED8 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001651.1-1137s1c1
Sequence:CCGGCCCTGGATTCATGTTTCTTATCTCGAGATAAGAAACATGAATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-409s1c1
Sequence:CCGGGAGAAGCAACTGACGACAGATCTCGAGATCTGTCGTCAGTTGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001651.1-219s1c1
Sequence:CCGGCACTCTGAACAAGGTCTTGAACTCGAGTTCAAGACCTTGTTCAGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_001001651.1-605s1c1
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-861s1c1
Sequence:CCGGCCTGGGTTTCATTCTGGCTATCTCGAGATAGCCAGAATGAAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001651.1-605s1c2
Sequence:CCGGCCTTTGGGAAAGGACTATCTACTCGAGTAGATAGTCCTTTCCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)