EMAIL THIS PAGE TO A FRIEND

MED9

mediator complex subunit 9

55 Gene Product Result for
Synonyms: MED25
UniProtKB ID: Q9NWA0
Gene ID:
Human(55090) Summary: The multiprotein Mediator complex is a coactivator required for activation of RNA polymerase II transcription by DNA bound transcription factors. The protein encoded by this gene is thought to be a subunit of the Mediator complex. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(192191) mediator of RNA polymerase II transcription, subunit 9 homolog (yeast)
Rat(497914) mediator complex subunit 9
fruit fly(37079) Mediator complex subunit 9
Thale Cress(841951) hypothetical protein
dog(609537) mediator complex subunit 9
cow(616966) mediator complex subunit 9
domestic cat(101080840) mediator complex subunit 9
chicken(416506) mediator complex subunit 9
naked mole-rat(101707824) mediator complex subunit 9
domestic guinea pig(100730534) mediator complex subunit 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018019 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018019 Rosetta Predictions human pricing
NM_001127302 Rosetta Predictions rat pricing
XM_573101 Rosetta Predictions rat pricing
NM_138675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064093 predicted 993
2 SASI_Hs01_00064094 predicted 983
3 SASI_Hs01_00064097 predicted 926
4 SASI_Hs01_00064098 predicted 987
5 SASI_Hs01_00064102 predicted 972
6 SASI_Hs01_00064095 predicted 697
7 SASI_Hs01_00064096 predicted 704
8 SASI_Hs02_00351121 predicted 955
9 SASI_Hs01_00064100 predicted 686
10 SASI_Hs01_00064101 predicted 910
11 SASI_Hs01_00064099 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253583 predicted 756
2 SASI_Rn02_00253584 predicted 514
3 SASI_Rn02_00253585 predicted 742
4 SASI_Rn02_00253586 predicted 742
5 SASI_Rn02_00253587 predicted 939
6 SASI_Rn02_00253588 predicted 705
7 SASI_Rn02_00253589 predicted 745
8 SASI_Rn02_00253590 predicted 749
9 SASI_Rn02_00253591 predicted 662
10 SASI_Rn02_00253592 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165156 predicted 2648
2 SASI_Rn01_00165157 predicted 2465
3 SASI_Rn01_00165158 predicted 2696
4 SASI_Rn01_00165159 predicted 2692
5 SASI_Rn01_00165160 predicted 268
6 SASI_Rn01_00165161 predicted 2657
7 SASI_Rn01_00165162 predicted 2458
8 SASI_Rn01_00165163 predicted 270
9 SASI_Rn01_00165164 predicted 2692
10 SASI_Rn01_00165165 predicted 2700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028831 predicted 781
2 SASI_Mm01_00028832 predicted 947
3 SASI_Mm01_00028833 predicted 815
4 SASI_Mm01_00028835 predicted 714
5 SASI_Mm01_00028836 predicted 249
6 SASI_Mm01_00028837 predicted 714
7 SASI_Mm01_00028838 predicted 787
8 SASI_Mm01_00028839 predicted 732
9 SASI_Mm01_00028840 predicted 233
10 SASI_Mm02_00339749 predicted 685
11 SASI_Mm01_00028834 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138675
VALIDATED
MED9 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138675.2-652s1c1
Sequence:CCGGCCGATAGCATCAGCATGGTATCTCGAGATACCATGCTGATGCTATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-410s1c1
Sequence:CCGGCAAGAGCCTCTGCATGTTTGACTCGAGTCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-407s1c1
Sequence:CCGGGTACAAGAGCCTCTGCATGTTCTCGAGAACATGCAGAGGCTCTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138675.3-445s21c1
Sequence:CCGGACAAGAGCCTCTGCATGTTTGCTCGAGCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-83s21c1
Sequence:CCGGACAGGCCGAAGATACGCTACACTCGAGTGTAGCGTATCTTCGGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-237s21c1
Sequence:CCGGTTGCCGTTGGTTCACAATGTCCTCGAGGACATTGTGAACCAACGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-211s21c1
Sequence:CCGGGCGCGAAGGAGGAGAATTACTCTCGAGAGTAATTCTCCTCCTTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138675.3-1425s21c1
Sequence:CCGGGGTGAGAAGAACCCAGTTATTCTCGAGAATAACTGGGTTCTTCTCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138675
VALIDATED
MED9 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138675.2-652s1c1
Sequence:CCGGCCGATAGCATCAGCATGGTATCTCGAGATACCATGCTGATGCTATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-410s1c1
Sequence:CCGGCAAGAGCCTCTGCATGTTTGACTCGAGTCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-407s1c1
Sequence:CCGGGTACAAGAGCCTCTGCATGTTCTCGAGAACATGCAGAGGCTCTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138675.3-445s21c1
Sequence:CCGGACAAGAGCCTCTGCATGTTTGCTCGAGCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-83s21c1
Sequence:CCGGACAGGCCGAAGATACGCTACACTCGAGTGTAGCGTATCTTCGGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-237s21c1
Sequence:CCGGTTGCCGTTGGTTCACAATGTCCTCGAGGACATTGTGAACCAACGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-211s21c1
Sequence:CCGGGCGCGAAGGAGGAGAATTACTCTCGAGAGTAATTCTCCTCCTTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138675.3-1425s21c1
Sequence:CCGGGGTGAGAAGAACCCAGTTATTCTCGAGAATAACTGGGTTCTTCTCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138675
VALIDATED
MED9 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183956    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138675.2-652s1c1
Sequence:CCGGCCGATAGCATCAGCATGGTATCTCGAGATACCATGCTGATGCTATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-410s1c1
Sequence:CCGGCAAGAGCCTCTGCATGTTTGACTCGAGTCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138675.2-407s1c1
Sequence:CCGGGTACAAGAGCCTCTGCATGTTCTCGAGAACATGCAGAGGCTCTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138675.3-445s21c1
Sequence:CCGGACAAGAGCCTCTGCATGTTTGCTCGAGCAAACATGCAGAGGCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-83s21c1
Sequence:CCGGACAGGCCGAAGATACGCTACACTCGAGTGTAGCGTATCTTCGGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-237s21c1
Sequence:CCGGTTGCCGTTGGTTCACAATGTCCTCGAGGACATTGTGAACCAACGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_138675.3-211s21c1
Sequence:CCGGGCGCGAAGGAGGAGAATTACTCTCGAGAGTAATTCTCCTCCTTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138675.3-1425s21c1
Sequence:CCGGGGTGAGAAGAACCCAGTTATTCTCGAGAATAACTGGGTTCTTCTCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018019
MED9 MISSION shRNA Bacterial Glycerol Stock
mediator complex subunit 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-464s1c1
Sequence:CCGGGAGCCTCTGCATGTTCGAAATCTCGAGATTTCGAACATGCAGAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-91s1c1
Sequence:CCGGCGGAGGATGTATTGCCGCCAACTCGAGTTGGCGGCAATACATCCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-231s1c1
Sequence:CCGGGAGGAAGAGAACTACTCCTTTCTCGAGAAAGGAGTAGTTCTCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-269s1c1
Sequence:CCGGCATCATCAAATGCATGGACAACTCGAGTTGTCCATGCATTTGATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-436s1c1
Sequence:CCGGCCAAGAATGAGCTTCTGCAAACTCGAGTTTGCAGAAGCTCATTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-251s21c1
Sequence:CCGGTTTACCTTTGGTTCACAACATCTCGAGATGTTGTGAACCAAAGGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-424s21c1
Sequence:CCGGAGCAAGTCAGGACCAAGAATGCTCGAGCATTCTTGGTCCTGACTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-689s21c1
Sequence:CCGGGTTCCTCGTGTAGATCCATATCTCGAGATATGGATCTACACGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-929s21c1
Sequence:CCGGGTACACATTGTTCCTGTTAACCTCGAGGTTAACAGGAACAATGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-707s21c1
Sequence:CCGGTATGTCTAGATGCATAATAACCTCGAGGTTATTATGCATCTAGACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018019
MED9 MISSION shRNA shRNA Plasmid DNA
mediator complex subunit 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-464s1c1
Sequence:CCGGGAGCCTCTGCATGTTCGAAATCTCGAGATTTCGAACATGCAGAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-91s1c1
Sequence:CCGGCGGAGGATGTATTGCCGCCAACTCGAGTTGGCGGCAATACATCCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-231s1c1
Sequence:CCGGGAGGAAGAGAACTACTCCTTTCTCGAGAAAGGAGTAGTTCTCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-269s1c1
Sequence:CCGGCATCATCAAATGCATGGACAACTCGAGTTGTCCATGCATTTGATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000053173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-436s1c1
Sequence:CCGGCCAAGAATGAGCTTCTGCAAACTCGAGTTTGCAGAAGCTCATTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-251s21c1
Sequence:CCGGTTTACCTTTGGTTCACAACATCTCGAGATGTTGTGAACCAAAGGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-424s21c1
Sequence:CCGGAGCAAGTCAGGACCAAGAATGCTCGAGCATTCTTGGTCCTGACTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-689s21c1
Sequence:CCGGGTTCCTCGTGTAGATCCATATCTCGAGATATGGATCTACACGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-929s21c1
Sequence:CCGGGTACACATTGTTCCTGTTAACCTCGAGGTTAACAGGAACAATGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-707s21c1
Sequence:CCGGTATGTCTAGATGCATAATAACCTCGAGGTTATTATGCATCTAGACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018019
MED9 MISSION shRNA Lentiviral Transduction Particles
mediator complex subunit 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-464s1c1
Sequence:CCGGGAGCCTCTGCATGTTCGAAATCTCGAGATTTCGAACATGCAGAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-91s1c1
Sequence:CCGGCGGAGGATGTATTGCCGCCAACTCGAGTTGGCGGCAATACATCCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-231s1c1
Sequence:CCGGGAGGAAGAGAACTACTCCTTTCTCGAGAAAGGAGTAGTTCTCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-269s1c1
Sequence:CCGGCATCATCAAATGCATGGACAACTCGAGTTGTCCATGCATTTGATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000053173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018019.2-436s1c1
Sequence:CCGGCCAAGAATGAGCTTCTGCAAACTCGAGTTTGCAGAAGCTCATTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-251s21c1
Sequence:CCGGTTTACCTTTGGTTCACAACATCTCGAGATGTTGTGAACCAAAGGTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018019.2-424s21c1
Sequence:CCGGAGCAAGTCAGGACCAAGAATGCTCGAGCATTCTTGGTCCTGACTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-689s21c1
Sequence:CCGGGTTCCTCGTGTAGATCCATATCTCGAGATATGGATCTACACGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433183    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-929s21c1
Sequence:CCGGGTACACATTGTTCCTGTTAACCTCGAGGTTAACAGGAACAATGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018019.2-707s21c1
Sequence:CCGGTATGTCTAGATGCATAATAACCTCGAGGTTATTATGCATCTAGACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)