EMAIL THIS PAGE TO A FRIEND

MEDAG

mesenteric estrogen-dependent adipogenesis

90 Gene Product Result for
Synonyms: AWMS3 C13orf33 MEDA-4 MEDA4 hAWMS3
UniProtKB ID: Q5VYS4, Q8IXF1, Q96K26, Q96NC8
Gene ID:
Mouse(70717) mesenteric estrogen dependent adipogenesis
Rat(360757) mesenteric estrogen-dependent adipogenesis
domestic guinea pig(100734009) mesenteric estrogen-dependent adipogenesis
naked mole-rat(101697389) mesenteric estrogen-dependent adipogenesis
sheep(101111297) mesenteric estrogen-dependent adipogenesis
cow(510187) mesenteric estrogen-dependent adipogenesis
domestic cat(101100273) mesenteric estrogen-dependent adipogenesis
dog(607966) mesenteric estrogen-dependent adipogenesis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032849 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032849 Rosetta Predictions human pricing
XM_001059692 Rosetta Predictions rat pricing
XM_341029 Rosetta Predictions rat pricing
NM_027519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082739 predicted 895
2 SASI_Hs02_00360445 predicted 1024
3 SASI_Hs01_00082740 predicted 981
4 SASI_Hs01_00082741 predicted 1219
5 SASI_Hs01_00082742 predicted 792
6 SASI_Hs01_00082743 predicted 1103
7 SASI_Hs01_00082744 predicted 1186
8 SASI_Hs01_00082745 predicted 1317
9 SASI_Hs01_00082746 predicted 857
10 SASI_Hs01_00082747 predicted 1170
11 SASI_Hs01_00082738 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293978 predicted 1016
2 SASI_Rn02_00293979 predicted 777
3 SASI_Rn02_00293980 predicted 1157
4 SASI_Rn02_00293981 predicted 559
5 SASI_Rn02_00293982 predicted 1064
6 SASI_Rn02_00293983 predicted 587
7 SASI_Rn02_00293984 predicted 1189
8 SASI_Rn02_00293985 predicted 660
9 SASI_Rn02_00293986 predicted 767
10 SASI_Rn02_00293987 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392260 predicted 1014
2 SASI_Rn02_00392261 predicted 780
3 SASI_Rn02_00392262 predicted 1162
4 SASI_Rn02_00392263 predicted 557
5 SASI_Rn02_00392264 predicted 1068
6 SASI_Rn02_00392265 predicted 582
7 SASI_Rn02_00392266 predicted 1188
8 SASI_Rn02_00392267 predicted 660
9 SASI_Rn02_00392268 predicted 771
10 SASI_Rn02_00392269 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066764 predicted 1073
2 SASI_Mm01_00066765 predicted 914
3 SASI_Mm01_00066766 predicted 659
4 SASI_Mm02_00332350 predicted 1036
5 SASI_Mm01_00066767 predicted 892
6 SASI_Mm01_00066768 predicted 507
7 SASI_Mm01_00066769 predicted 639
8 SASI_Mm01_00066770 predicted 942
9 SASI_Mm01_00066772 predicted 456
10 SASI_Mm02_00332351 predicted 437
11 SASI_Mm01_00066771 predicted 876
12 SASI_Mm01_00066773 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032849
MEDAG MISSION shRNA Bacterial Glycerol Stock
mesenteric estrogen-dependent adipogenesis
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-1229s21c1
Sequence:CCGGAGAGACACCCAACCAATTTATCTCGAGATAAATTGGTTGGGTGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-734s21c1
Sequence:CCGGGACGTACGCGTTTCTTGTAAACTCGAGTTTACAAGAAACGCGTACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-968s21c1
Sequence:CCGGGCTCAGTAATTCCGTTGTAAACTCGAGTTTACAACGGAATTACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-632s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-658s1c1
Sequence:CCGGGAGCAAACCAATGTTGTTCTTCTCGAGAAGAACAACATTGGTTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1074s1c1
Sequence:CCGGGCAGTTTCTCTGACCGAAAGTCTCGAGACTTTCGGTCAGAGAAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032849.2-1792s1c1
Sequence:CCGGGCCATATGACACCTATGAGAACTCGAGTTCTCATAGGTGTCATATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1188s1c1
Sequence:CCGGCATTTCCAAGTGTTCTGGAATCTCGAGATTCCAGAACACTTGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-796s1c1
Sequence:CCGGCTCAGTGATTGGAGAAAGTTACTCGAGTAACTTTCTCCAATCACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032849
MEDAG MISSION shRNA shRNA Plasmid DNA
mesenteric estrogen-dependent adipogenesis
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-1229s21c1
Sequence:CCGGAGAGACACCCAACCAATTTATCTCGAGATAAATTGGTTGGGTGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-734s21c1
Sequence:CCGGGACGTACGCGTTTCTTGTAAACTCGAGTTTACAAGAAACGCGTACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-968s21c1
Sequence:CCGGGCTCAGTAATTCCGTTGTAAACTCGAGTTTACAACGGAATTACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-632s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-658s1c1
Sequence:CCGGGAGCAAACCAATGTTGTTCTTCTCGAGAAGAACAACATTGGTTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1074s1c1
Sequence:CCGGGCAGTTTCTCTGACCGAAAGTCTCGAGACTTTCGGTCAGAGAAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032849.2-1792s1c1
Sequence:CCGGGCCATATGACACCTATGAGAACTCGAGTTCTCATAGGTGTCATATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1188s1c1
Sequence:CCGGCATTTCCAAGTGTTCTGGAATCTCGAGATTCCAGAACACTTGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-796s1c1
Sequence:CCGGCTCAGTGATTGGAGAAAGTTACTCGAGTAACTTTCTCCAATCACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032849
MEDAG MISSION shRNA Lentiviral Transduction Particles
mesenteric estrogen-dependent adipogenesis
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-1229s21c1
Sequence:CCGGAGAGACACCCAACCAATTTATCTCGAGATAAATTGGTTGGGTGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-734s21c1
Sequence:CCGGGACGTACGCGTTTCTTGTAAACTCGAGTTTACAAGAAACGCGTACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-968s21c1
Sequence:CCGGGCTCAGTAATTCCGTTGTAAACTCGAGTTTACAACGGAATTACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032849.3-632s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-658s1c1
Sequence:CCGGGAGCAAACCAATGTTGTTCTTCTCGAGAAGAACAACATTGGTTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1074s1c1
Sequence:CCGGGCAGTTTCTCTGACCGAAAGTCTCGAGACTTTCGGTCAGAGAAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032849.2-1792s1c1
Sequence:CCGGGCCATATGACACCTATGAGAACTCGAGTTCTCATAGGTGTCATATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-1188s1c1
Sequence:CCGGCATTTCCAAGTGTTCTGGAATCTCGAGATTCCAGAACACTTGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032849.2-796s1c1
Sequence:CCGGCTCAGTGATTGGAGAAAGTTACTCGAGTAACTTTCTCCAATCACTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027519
VALIDATED
MEDAG MISSION shRNA Bacterial Glycerol Stock
mesenteric estrogen-dependent adipogenesis
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027519.3-1532s21c1
Sequence:CCGGAGGTAAAGCCAGTACTGATATCTCGAGATATCAGTACTGGCTTTACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027519.3-463s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-711s1c1
Sequence:CCGGCCAGGAACGATTGTGCTGAATCTCGAGATTCAGCACAATCGTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-1003s1c1
Sequence:CCGGCATCGGTTACAGAACCACTTTCTCGAGAAAGTGGTTCTGTAACCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-1059s1c1
Sequence:CCGGGAAGAGACATCCAGCCAACTTCTCGAGAAGTTGGCTGGATGTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-925s1c1
Sequence:CCGGGTTTCTCTGATCGGAAATTTACTCGAGTAAATTTCCGATCAGAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-2233s1c1
Sequence:CCGGGCGTTCAACTTGTAATGGATTCTCGAGAATCCATTACAAGTTGAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027519
VALIDATED
MEDAG MISSION shRNA shRNA Plasmid DNA
mesenteric estrogen-dependent adipogenesis
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027519.3-1532s21c1
Sequence:CCGGAGGTAAAGCCAGTACTGATATCTCGAGATATCAGTACTGGCTTTACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027519.3-463s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-711s1c1
Sequence:CCGGCCAGGAACGATTGTGCTGAATCTCGAGATTCAGCACAATCGTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-1003s1c1
Sequence:CCGGCATCGGTTACAGAACCACTTTCTCGAGAAAGTGGTTCTGTAACCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-1059s1c1
Sequence:CCGGGAAGAGACATCCAGCCAACTTCTCGAGAAGTTGGCTGGATGTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-925s1c1
Sequence:CCGGGTTTCTCTGATCGGAAATTTACTCGAGTAAATTTCCGATCAGAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-2233s1c1
Sequence:CCGGGCGTTCAACTTGTAATGGATTCTCGAGAATCCATTACAAGTTGAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027519
VALIDATED
MEDAG MISSION shRNA Lentiviral Transduction Particles
mesenteric estrogen-dependent adipogenesis
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027519.3-1532s21c1
Sequence:CCGGAGGTAAAGCCAGTACTGATATCTCGAGATATCAGTACTGGCTTTACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027519.3-463s21c1
Sequence:CCGGGACCAACTACTGTGATTATAACTCGAGTTATAATCACAGTAGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-711s1c1
Sequence:CCGGCCAGGAACGATTGTGCTGAATCTCGAGATTCAGCACAATCGTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027519.1-1003s1c1
Sequence:CCGGCATCGGTTACAGAACCACTTTCTCGAGAAAGTGGTTCTGTAACCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-1059s1c1
Sequence:CCGGGAAGAGACATCCAGCCAACTTCTCGAGAAGTTGGCTGGATGTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-925s1c1
Sequence:CCGGGTTTCTCTGATCGGAAATTTACTCGAGTAAATTTCCGATCAGAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201353    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027519.1-2233s1c1
Sequence:CCGGGCGTTCAACTTGTAATGGATTCTCGAGAATCCATTACAAGTTGAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)