EMAIL THIS PAGE TO A FRIEND

MEF2A

myocyte enhancer factor 2A

150 Gene Product Result for
Synonyms: ADCAD1 RSRFC4 RSRFC9 mef2
Gene ID:
Human(4205) Summary: The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(17258) myocyte enhancer factor 2A
Rat(309957) myocyte enhancer factor 2a
chicken(395670) myocyte enhancer factor 2A
dog(479021) myocyte enhancer factor 2A
domestic cat(101098464) myocyte enhancer factor 2A
cow(407231) myocyte enhancer factor 2A
Horse(100050068) myocyte enhancer factor 2A
sheep(101116680) myocyte enhancer factor 2A
naked mole-rat(101705046) myocyte enhancer factor 2A
Domestic Rabbit(100339777) myocyte enhancer factor 2A
domestic guinea pig(100715067) myocyte enhancer factor 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300322 Anti-MEF2A (Ab-312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300323 Anti-MEF2A (Ab-319) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB2101459 Anti-MEF2A (ab1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2101460 Anti-MEF2A (ab2) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2101461 Anti-MEF2A (ab3) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1412051 ANTI-MEF2A antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412052 ANTI-MEF2A antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412178 ANTI-MEF2A antibody produced in mouse clone 1A7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412353 ANTI-MEF2A antibody produced in mouse clone 1F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1412542 ANTI-MEF2A antibody produced in mouse clone 2G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412543 ANTI-MEF2A antibody produced in mouse clone 2F10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412544 ANTI-MEF2A antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412662 ANTI-MEF2A antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
AV37186 Anti-MEF2A antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA056563 Anti-MEF2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4501855 Anti-MEF2A antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501856 Anti-MEF2A antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4501857 Anti-MEF2A antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
HPA046597 Anti-MEF2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4300242 Anti-phospho-MEF2A (pSer408) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
SAB4503770 Anti-phospho-MEF2A (pSer408) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4300028 Anti-phospho-MEF2A (pThr312) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
SAB4504464 Anti-phospho-MEF2A (pThr312) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4300029 Anti-phospho-MEF2A (pThr319) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence pricing
SAB4504465 Anti-phospho-MEF2A (pThr319) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
WH0004205M1 Monoclonal Anti-MEF2A antibody produced in mouse clone 3F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404064 Monoclonal Anti-MEF2A antibody produced in mouse clone 1A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194070 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194070 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194070 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005587 Rosetta Predictions human pricing
NM_001014035 Rosetta Predictions rat pricing
NM_001033713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339880 predicted 634
2 SASI_Hs01_00021664 predicted 959
3 SASI_Hs02_00339881 predicted 482
4 SASI_Hs01_00021666 predicted 649
5 SASI_Hs01_00021667 predicted 713
6 SASI_Hs01_00021668 predicted 1088
7 SASI_Hs01_00021669 predicted 1415
8 SASI_Hs01_00021670 predicted 1133
9 SASI_Hs01_00021671 predicted 506
10 SASI_Hs01_00021672 predicted 490
11 SASI_Hs01_00021665 predicted 1110
12 SASI_Hs01_00021673 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088302 predicted 542
2 SASI_Rn01_00088304 predicted 523
3 SASI_Rn01_00088305 predicted 974
4 SASI_Rn01_00088306 predicted 742
5 SASI_Rn01_00088307 predicted 1105
6 SASI_Rn02_00201421 predicted 377
7 SASI_Rn02_00201422 predicted 445
8 SASI_Rn01_00088308 predicted 387
9 SASI_Rn01_00088309 predicted 594
10 SASI_Rn01_00088310 predicted 1275
11 SASI_Rn01_00088303 predicted 454
12 SASI_Rn01_00088311 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120787 predicted 1000
2 SASI_Mm01_00120788 predicted 774
3 SASI_Mm01_00120789 predicted 573
4 SASI_Mm01_00120790 predicted 415
5 SASI_Mm01_00120791 predicted 552
6 SASI_Mm01_00120792 predicted 1530
7 SASI_Mm01_00120793 predicted 636
8 SASI_Mm01_00120794 predicted 403
9 SASI_Mm01_00120795 predicted 671
10 SASI_Mm01_00120796 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194070
VALIDATED
MEF2A MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-2801s1c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1605s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1191s1c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-986s1c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1891s1c1
Sequence:CCGGCCAAATACTGAGGACAGAGAACTCGAGTTCTCTGTCCTCAGTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194070
VALIDATED
MEF2A MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-2801s1c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1605s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1191s1c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-986s1c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1891s1c1
Sequence:CCGGCCAAATACTGAGGACAGAGAACTCGAGTTCTCTGTCCTCAGTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194070
VALIDATED
MEF2A MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-2801s1c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1605s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1191s1c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-986s1c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_194070.1-1891s1c1
Sequence:CCGGCCAAATACTGAGGACAGAGAACTCGAGTTCTCTGTCCTCAGTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005587
VALIDATED
MEF2A MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-2628s1c1
Sequence:CCGGGCCTAGAAATATAGAGCATTACTCGAGTAATGCTCTATATTTCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005587.1-586s1c1
Sequence:CCGGGCTAGCACTGATATGGACAAACTCGAGTTTGTCCATATCAGTGCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1755s21c1
Sequence:CCGGAGCTCTAGTAGCTCCTATGATCTCGAGATCATAGGAGCTACTAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-633s21c1
Sequence:CCGGAGCAGAACCAACTCGGATATTCTCGAGAATATCCGAGTTGGTTCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1566s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCCAACTCGAGTTGGAACCCTGAGATAACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-709s1c1
Sequence:CCGGCCAGACCCTGATACTTCATATCTCGAGATATGAAGTATCAGGGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1151s1c1
Sequence:CCGGGCTTAGGCAAAGTCATGCCTACTCGAGTAGGCATGACTTTGCCTAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1579s21c1
Sequence:CCGGGCATCAAGTCCGAACCGATTTCTCGAGAAATCGGTTCGGACTTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-551s21c1
Sequence:CCGGCTCTAACAAACTGTTTCAATACTCGAGTATTGAAACAGTTTGTTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-523s21c1
Sequence:CCGGGTGAAATAGCACTCATCATTTCTCGAGAAATGATGAGTGCTATTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005587.2-2176s21c1
Sequence:CCGGTTGGACTACTTGTTTCGTAAACTCGAGTTTACGAAACAAGTAGTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005587
VALIDATED
MEF2A MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-2628s1c1
Sequence:CCGGGCCTAGAAATATAGAGCATTACTCGAGTAATGCTCTATATTTCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005587.1-586s1c1
Sequence:CCGGGCTAGCACTGATATGGACAAACTCGAGTTTGTCCATATCAGTGCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1755s21c1
Sequence:CCGGAGCTCTAGTAGCTCCTATGATCTCGAGATCATAGGAGCTACTAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-633s21c1
Sequence:CCGGAGCAGAACCAACTCGGATATTCTCGAGAATATCCGAGTTGGTTCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1566s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCCAACTCGAGTTGGAACCCTGAGATAACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-709s1c1
Sequence:CCGGCCAGACCCTGATACTTCATATCTCGAGATATGAAGTATCAGGGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1151s1c1
Sequence:CCGGGCTTAGGCAAAGTCATGCCTACTCGAGTAGGCATGACTTTGCCTAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1579s21c1
Sequence:CCGGGCATCAAGTCCGAACCGATTTCTCGAGAAATCGGTTCGGACTTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-551s21c1
Sequence:CCGGCTCTAACAAACTGTTTCAATACTCGAGTATTGAAACAGTTTGTTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-523s21c1
Sequence:CCGGGTGAAATAGCACTCATCATTTCTCGAGAAATGATGAGTGCTATTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005587.2-2176s21c1
Sequence:CCGGTTGGACTACTTGTTTCGTAAACTCGAGTTTACGAAACAAGTAGTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005587
VALIDATED
MEF2A MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-2628s1c1
Sequence:CCGGGCCTAGAAATATAGAGCATTACTCGAGTAATGCTCTATATTTCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005587.1-586s1c1
Sequence:CCGGGCTAGCACTGATATGGACAAACTCGAGTTTGTCCATATCAGTGCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1755s21c1
Sequence:CCGGAGCTCTAGTAGCTCCTATGATCTCGAGATCATAGGAGCTACTAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-633s21c1
Sequence:CCGGAGCAGAACCAACTCGGATATTCTCGAGAATATCCGAGTTGGTTCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1566s1c1
Sequence:CCGGGCAGTTATCTCAGGGTTCCAACTCGAGTTGGAACCCTGAGATAACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-709s1c1
Sequence:CCGGCCAGACCCTGATACTTCATATCTCGAGATATGAAGTATCAGGGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005587.1-1151s1c1
Sequence:CCGGGCTTAGGCAAAGTCATGCCTACTCGAGTAGGCATGACTTTGCCTAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-1579s21c1
Sequence:CCGGGCATCAAGTCCGAACCGATTTCTCGAGAAATCGGTTCGGACTTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-551s21c1
Sequence:CCGGCTCTAACAAACTGTTTCAATACTCGAGTATTGAAACAGTTTGTTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005587.2-523s21c1
Sequence:CCGGGTGAAATAGCACTCATCATTTCTCGAGAAATGATGAGTGCTATTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005587.2-2176s21c1
Sequence:CCGGTTGGACTACTTGTTTCGTAAACTCGAGTTTACGAAACAAGTAGTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033713
MEF2A MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000333988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033713.1-2678s21c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1482s21c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1044s21c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-839s21c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033713
MEF2A MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000333988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033713.1-2678s21c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1482s21c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1044s21c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-839s21c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033713
MEF2A MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000333988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033713.1-2678s21c1
Sequence:CCGGCCCTTAATGAATTGATGACTACTCGAGTAGTCATCAATTCATTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1482s21c1
Sequence:CCGGGCAGTTATCTCAGGGTTCAAACTCGAGTTTGAACCCTGAGATAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-1044s21c1
Sequence:CCGGGATTGGAAATACTGGTGCAAACTCGAGTTTGCACCAGTATTTCCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033713.1-839s21c1
Sequence:CCGGCCAGCTCAACATTAGCAGATTCTCGAGAATCTGCTAATGTTGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)