EMAIL THIS PAGE TO A FRIEND

MEF2B

myocyte enhancer factor 2B

70 Gene Product Result for
Synonyms: RSRFR2
UniProtKB ID: Q02080, A0AV80, B4DVH7, B7ZVY1, G5E9M1
Gene ID:
Human(100271849) Summary: The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (geneID:729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as geneID:4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on geneID:4207. [provided by RefSeq, Mar 2009]
Mouse(17259) myocyte enhancer factor 2B
Rat(498607) myocyte enhancer factor 2B
Zebrafish(558073) myocyte enhancer factor 2b
domestic cat(101090497) myocyte enhancer factor 2B
dog(609739) myocyte enhancer factor 2B
cow(100271851) myocyte enhancer factor 2B
chicken(426373) myocyte enhancer factor 2B
domestic guinea pig(100716341) myocyte enhancer factor 2B
naked mole-rat(101711927) myocyte enhancer factor 2B
sheep(101106075) myocyte enhancer factor 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU163391 MISSION® esiRNA esiRNA targeting mouse Mef2b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017507 Rosetta Predictions rat pricing
NM_001045484 Rosetta Predictions mouse pricing
NM_008578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041337 predicted 308
2 SASI_Rn01_00041338 predicted 304
3 SASI_Rn01_00041339 predicted 296
4 SASI_Rn01_00041340 predicted 963
5 SASI_Rn01_00041341 predicted 466
6 SASI_Rn01_00041342 predicted 304
7 SASI_Rn01_00041343 predicted 956
8 SASI_Rn02_00202336 predicted 940
9 SASI_Rn01_00041345 predicted 300
10 SASI_Rn01_00041346 predicted 335
11 SASI_Rn01_00041344 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291484 predicted 205
2 SASI_Mm02_00291485 predicted 267
3 SASI_Mm02_00291486 predicted 491
4 SASI_Mm02_00291487 predicted 959
5 SASI_Mm02_00291488 predicted 295
6 SASI_Mm02_00291489 predicted 317
7 SASI_Mm02_00291490 predicted 494
8 SASI_Mm02_00291491 predicted 326
9 SASI_Mm02_00291492 predicted 316
10 SASI_Mm02_00291493 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314199 predicted 208
2 SASI_Mm02_00314200 predicted 268
3 SASI_Mm02_00314201 predicted 484
4 SASI_Mm02_00314202 predicted 985
5 SASI_Mm02_00314203 predicted 293
6 SASI_Mm02_00314204 predicted 323
7 SASI_Mm02_00314205 predicted 488
8 SASI_Mm02_00314206 predicted 330
9 SASI_Mm01_00156391 predicted 323
10 SASI_Mm02_00314207 predicted 286
11 SASI_Mm01_00156386 predicted 667
12 SASI_Mm01_00156387 predicted 336
13 SASI_Mm01_00156388 predicted 543
14 SASI_Mm01_00156389 predicted 745
15 SASI_Mm01_00156390 predicted 914
16 SASI_Mm01_00156392 predicted 964
17 SASI_Mm01_00156393 predicted 335
18 SASI_Mm01_00156394 predicted 882
19 SASI_Mm01_00156395 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008578
MEF2B MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-501s21c1
Sequence:CCGGTCGGTTTCAGAGCTGTCCTACCTCGAGGTAGGACAGCTCTGAAACCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-333s21c1
Sequence:CCGGGCGGATATCCTTCAGACACTGCTCGAGCAGTGTCTGAAGGATATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-800s21c1
Sequence:CCGGTAGCTTTGCCTTCTTACCATCCTCGAGGATGGTAAGAAGGCAAAGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-739s21c1
Sequence:CCGGGCACCTCAAGAAGCCTGTACACTCGAGTGTACAGGCTTCTTGAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-1115s1c1
Sequence:CCGGCCCTGACAGCTGGCCACGGTACTCGAGTACCGTGGCCAGCTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-195s1c1
Sequence:CCGGGTGCTTTGTGACTGCGACATTCTCGAGAATGTCGCAGTCACAAAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-663s1c1
Sequence:CCGGCCTCTGTACCTGGCGACTGATCTCGAGATCAGTCGCCAGGTACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-281s1c1
Sequence:CCGGGCTGCTCAAATACACCGAGTACTCGAGTACTCGGTGTATTTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-986s21c1
Sequence:CCGGCATCAAGTCTGAGCGACTGTCCTCGAGGACAGTCGCTCAGACTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008578
MEF2B MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-501s21c1
Sequence:CCGGTCGGTTTCAGAGCTGTCCTACCTCGAGGTAGGACAGCTCTGAAACCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-333s21c1
Sequence:CCGGGCGGATATCCTTCAGACACTGCTCGAGCAGTGTCTGAAGGATATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-800s21c1
Sequence:CCGGTAGCTTTGCCTTCTTACCATCCTCGAGGATGGTAAGAAGGCAAAGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-739s21c1
Sequence:CCGGGCACCTCAAGAAGCCTGTACACTCGAGTGTACAGGCTTCTTGAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-1115s1c1
Sequence:CCGGCCCTGACAGCTGGCCACGGTACTCGAGTACCGTGGCCAGCTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-195s1c1
Sequence:CCGGGTGCTTTGTGACTGCGACATTCTCGAGAATGTCGCAGTCACAAAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-663s1c1
Sequence:CCGGCCTCTGTACCTGGCGACTGATCTCGAGATCAGTCGCCAGGTACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-281s1c1
Sequence:CCGGGCTGCTCAAATACACCGAGTACTCGAGTACTCGGTGTATTTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-986s21c1
Sequence:CCGGCATCAAGTCTGAGCGACTGTCCTCGAGGACAGTCGCTCAGACTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008578
MEF2B MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-501s21c1
Sequence:CCGGTCGGTTTCAGAGCTGTCCTACCTCGAGGTAGGACAGCTCTGAAACCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-333s21c1
Sequence:CCGGGCGGATATCCTTCAGACACTGCTCGAGCAGTGTCTGAAGGATATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-800s21c1
Sequence:CCGGTAGCTTTGCCTTCTTACCATCCTCGAGGATGGTAAGAAGGCAAAGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-739s21c1
Sequence:CCGGGCACCTCAAGAAGCCTGTACACTCGAGTGTACAGGCTTCTTGAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-1115s1c1
Sequence:CCGGCCCTGACAGCTGGCCACGGTACTCGAGTACCGTGGCCAGCTGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-195s1c1
Sequence:CCGGGTGCTTTGTGACTGCGACATTCTCGAGAATGTCGCAGTCACAAAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-663s1c1
Sequence:CCGGCCTCTGTACCTGGCGACTGATCTCGAGATCAGTCGCCAGGTACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008578.1-281s1c1
Sequence:CCGGGCTGCTCAAATACACCGAGTACTCGAGTACTCGGTGTATTTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008578.2-986s21c1
Sequence:CCGGCATCAAGTCTGAGCGACTGTCCTCGAGGACAGTCGCTCAGACTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)