EMAIL THIS PAGE TO A FRIEND

MEF2BNB

MEF2B neighbor

49 Gene Product Result for
UniProtKB ID: Q96FH0, B2RXF9, Q9BT01
Gene ID:
Rat(688966) MEF2B neighbor
sheep(101106256) MEF2B neighbor
naked mole-rat(101713491) MEF2B neighbor
Zebrafish(558180) mef2b neighbor
cow(100271850) MEF2B neighbor
domestic cat(101098287) MEF2B neighbor
dog(609124) MEF2B neighbor
chicken(426622) MEF2B neighbor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145784 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_041227 Rosetta Predictions human pricing
XR_041228 Rosetta Predictions human pricing
XR_041229 Rosetta Predictions human pricing
XM_001067949 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525678 predicted 524
2 SASI_Hs02_00525679 predicted 415
3 SASI_Hs02_00525680 predicted 429
4 SASI_Hs02_00525681 predicted 429
5 SASI_Hs02_00525682 predicted 536
6 SASI_Hs02_00525683 predicted 378
7 SASI_Hs02_00525684 predicted 530
8 SASI_Hs02_00525685 predicted 407
9 SASI_Hs02_00525686 predicted 685
10 SASI_Hs02_00525687 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525688 predicted 522
2 SASI_Hs02_00525689 predicted 410
3 SASI_Hs02_00525690 predicted 431
4 SASI_Hs02_00525691 predicted 430
5 SASI_Hs02_00525692 predicted 536
6 SASI_Hs02_00525693 predicted 381
7 SASI_Hs02_00525694 predicted 532
8 SASI_Hs02_00525695 predicted 407
9 SASI_Hs02_00525696 predicted 679
10 SASI_Hs02_00525697 predicted 677
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525698 predicted 524
2 SASI_Hs02_00525699 predicted 410
3 SASI_Hs02_00525700 predicted 422
4 SASI_Hs02_00525701 predicted 424
5 SASI_Hs02_00525702 predicted 536
6 SASI_Hs02_00525703 predicted 380
7 SASI_Hs02_00525704 predicted 533
8 SASI_Hs02_00525705 predicted 415
9 SASI_Hs02_00525706 predicted 678
10 SASI_Hs02_00525707 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322919 predicted 585
2 SASI_Rn02_00322920 predicted 207
3 SASI_Rn02_00322921 predicted 307
4 SASI_Rn02_00322922 predicted 601
5 SASI_Rn02_00322923 predicted 533
6 SASI_Rn02_00322924 predicted 452
7 SASI_Rn02_00322925 predicted 581
8 SASI_Rn02_00322926 predicted 297
9 SASI_Rn02_00322927 predicted 268
10 SASI_Rn02_00322928 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145784
MEF2BNB MISSION shRNA Bacterial Glycerol Stock
MEF2B neighbor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1067s21c1
Sequence:CCGGTCTACCCTCCCAACCTGCATTCTCGAGAATGCAGGTTGGGAGGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1277s21c1
Sequence:CCGGGAAGGTTGAGCTGGGTGTATGCTCGAGCATACACCCAGCTCAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-998s21c1
Sequence:CCGGCCCTTTCTTCATCTGGATAAGCTCGAGCTTATCCAGATGAAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1199s21c1
Sequence:CCGGAGGTTCCTAGTGATTGGTTTGCTCGAGCAAACCAATCACTAGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1231s21c1
Sequence:CCGGTGACCCAATGAGCGACCTTTCCTCGAGGAAAGGTCGCTCATTGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1052s21c1
Sequence:CCGGTTGGACATTCGCAGATCTACCCTCGAGGGTAGATCTGCGAATGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1188s21c1
Sequence:CCGGTCCCTTGTCCTAGGTTCCTAGCTCGAGCTAGGAACCTAGGACAAGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-986s21c1
Sequence:CCGGAGCCTTGGTTCTCCCTTTCTTCTCGAGAAGAAAGGGAGAACCAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145784
MEF2BNB MISSION shRNA shRNA Plasmid DNA
MEF2B neighbor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1067s21c1
Sequence:CCGGTCTACCCTCCCAACCTGCATTCTCGAGAATGCAGGTTGGGAGGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1277s21c1
Sequence:CCGGGAAGGTTGAGCTGGGTGTATGCTCGAGCATACACCCAGCTCAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-998s21c1
Sequence:CCGGCCCTTTCTTCATCTGGATAAGCTCGAGCTTATCCAGATGAAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1199s21c1
Sequence:CCGGAGGTTCCTAGTGATTGGTTTGCTCGAGCAAACCAATCACTAGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1231s21c1
Sequence:CCGGTGACCCAATGAGCGACCTTTCCTCGAGGAAAGGTCGCTCATTGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1052s21c1
Sequence:CCGGTTGGACATTCGCAGATCTACCCTCGAGGGTAGATCTGCGAATGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1188s21c1
Sequence:CCGGTCCCTTGTCCTAGGTTCCTAGCTCGAGCTAGGAACCTAGGACAAGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-986s21c1
Sequence:CCGGAGCCTTGGTTCTCCCTTTCTTCTCGAGAAGAAAGGGAGAACCAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145784
MEF2BNB MISSION shRNA Lentiviral Transduction Particles
MEF2B neighbor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1067s21c1
Sequence:CCGGTCTACCCTCCCAACCTGCATTCTCGAGAATGCAGGTTGGGAGGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1277s21c1
Sequence:CCGGGAAGGTTGAGCTGGGTGTATGCTCGAGCATACACCCAGCTCAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-998s21c1
Sequence:CCGGCCCTTTCTTCATCTGGATAAGCTCGAGCTTATCCAGATGAAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1199s21c1
Sequence:CCGGAGGTTCCTAGTGATTGGTTTGCTCGAGCAAACCAATCACTAGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1231s21c1
Sequence:CCGGTGACCCAATGAGCGACCTTTCCTCGAGGAAAGGTCGCTCATTGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1052s21c1
Sequence:CCGGTTGGACATTCGCAGATCTACCCTCGAGGGTAGATCTGCGAATGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-1188s21c1
Sequence:CCGGTCCCTTGTCCTAGGTTCCTAGCTCGAGCTAGGAACCTAGGACAAGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145784.1-986s21c1
Sequence:CCGGAGCCTTGGTTCTCCCTTTCTTCTCGAGAAGAAAGGGAGAACCAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)