EMAIL THIS PAGE TO A FRIEND

MEF2C

myocyte enhancer factor 2C

202 Gene Product Result for
Synonyms: C5DELq14.3 DEL5q14.3
UniProtKB ID: Q06413, C9JMZ0, D7F7N5, F8W7V7
Gene ID:
Human(4208) Summary: This locus encodes a member of the MADS box transcription enhancer factor 2 (MEF2) family of proteins, which play a role in myogenesis. The encoded protein, MEF2 polypeptide C, has both trans-activating and DNA binding activities. This protein may play a role in maintaining the differentiated state of muscle cells. Mutations and deletions at this locus have been associated with severe mental retardation, stereotypic movements, epilepsy, and cerebral malformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
Mouse(17260) myocyte enhancer factor 2C
Rat(499497) myocyte enhancer factor 2C
chicken(769007) myocyte enhancer factor 2C
dog(479155) myocyte enhancer factor 2C
domestic cat(101096136) myocyte enhancer factor 2C
cow(512254) myocyte enhancer factor 2C
Horse(100065153) myocyte enhancer factor 2C
domestic guinea pig(100725079) myocyte enhancer factor 2C
naked mole-rat(101716335) myocyte enhancer factor 2C
sheep(100286738) myocyte enhancer factor 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105167 Anti-MEF2C (211-225) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1401241 Anti-MEF2C antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107941 Anti-MEF2C antibody produced in rabbit IgG fraction of antiserum dog, pig, rabbit, rat, human, mouse
western blot pricing
HPA005533 Anti-MEF2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
AV37342 Anti-MEF2C antibody produced in rabbit IgG fraction of antiserum, lyophilized powder mouse, rat, bovine, zebrafish, pig, human, canine,
western blot pricing
SAB2103534 Anti-MEF2C antibody produced in rabbit affinity isolated antibody dog, mouse, human, rat, horse, pig, rabbit
western blot pricing
SAB4501859 Anti-MEF2C antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4501860 Anti-MEF2C antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB1410781 Anti-MEF2C antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504712 Anti-phospho-MEF2C (pSer396) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301365 Anti-phospho-MEF2C (pSer396) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
AMAB90727 Monoclonal Anti-MEF2C antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0368, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB4100276 Monoclonal Anti-MEF2C antibody produced in mouse clone MEF2C-B247, culture supernatant human
western blot pricing
AMAB90728 Monoclonal Anti-MEF2C antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0369, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025282 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025282 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025282 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002397 Rosetta Predictions human pricing
XM_001056692 Rosetta Predictions rat pricing
XM_574821 Rosetta Predictions rat pricing
NM_025282 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233876 predicted 1148
2 SASI_Hs01_00233877 predicted 1123
3 SASI_Hs01_00233878 predicted 1416
4 SASI_Hs01_00233879 predicted 641
5 SASI_Hs01_00233881 predicted 1373
6 SASI_Hs01_00233882 predicted 1342
7 SASI_Hs01_00233884 predicted 418
8 SASI_Hs01_00233885 predicted 1325
9 SASI_Hs02_00333760 predicted 621
10 SASI_Hs02_00333761 predicted 420
11 SASI_Hs01_00233880 predicted 478
12 SASI_Hs01_00233883 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001056692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00284092 predicted 1186
2 SASI_Rn02_00284093 predicted 693
3 SASI_Rn02_00284094 predicted 704
4 SASI_Rn02_00284095 predicted 1212
5 SASI_Rn02_00284096 predicted 988
6 SASI_Rn02_00284097 predicted 1084
7 SASI_Rn02_00284098 predicted 1441
8 SASI_Rn02_00284099 predicted 1414
9 SASI_Rn02_00284100 predicted 1428
10 SASI_Rn02_00284101 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402657 predicted 326
2 SASI_Rn02_00402658 predicted 486
3 SASI_Rn02_00402659 predicted 538
4 SASI_Rn02_00402660 predicted 205
5 SASI_Rn02_00402661 predicted 1115
6 SASI_Rn02_00402662 predicted 293
7 SASI_Rn02_00402663 predicted 552
8 SASI_Rn02_00402664 predicted 204
9 SASI_Rn02_00402665 predicted 196
10 SASI_Rn02_00402666 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025282 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092891 predicted 655
2 SASI_Mm02_00327894 predicted 1355
3 SASI_Mm01_00092892 predicted 1213
4 SASI_Mm01_00092893 predicted 1330
5 SASI_Mm01_00092894 predicted 1130
6 SASI_Mm01_00092895 predicted 997
7 SASI_Mm01_00092896 predicted 863
8 SASI_Mm01_00092897 predicted 656
9 SASI_Mm01_00092898 predicted 1307
10 SASI_Mm01_00092899 predicted 1177
11 SASI_Mm01_00092900 predicted 1173
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002397
VALIDATED
MEF2C MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1458s21c1
Sequence:CCGGGCAGCAAGAATACGATGCCATCTCGAGATGGCATCGTATTCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-3232s1c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002397.2-1513s1c1
Sequence:CCGGGCACTCATTTATCTCAGAGTTCTCGAGAACTCTGAGATAAATGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-653s1c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-1127s1c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-925s21c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002397.3-3504s21c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1399s21c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002397
VALIDATED
MEF2C MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1458s21c1
Sequence:CCGGGCAGCAAGAATACGATGCCATCTCGAGATGGCATCGTATTCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-3232s1c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002397.2-1513s1c1
Sequence:CCGGGCACTCATTTATCTCAGAGTTCTCGAGAACTCTGAGATAAATGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-653s1c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-1127s1c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-925s21c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002397.3-3504s21c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1399s21c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002397
VALIDATED
MEF2C MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1458s21c1
Sequence:CCGGGCAGCAAGAATACGATGCCATCTCGAGATGGCATCGTATTCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-3232s1c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002397.2-1513s1c1
Sequence:CCGGGCACTCATTTATCTCAGAGTTCTCGAGAACTCTGAGATAAATGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-653s1c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002397.2-1127s1c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-925s21c1
Sequence:CCGGCGTGGAGACGTTGAGAAAGAACTCGAGTTCTTTCTCAACGTCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002397.3-3504s21c1
Sequence:CCGGGCCTAGAATTTGATACGCTTTCTCGAGAAAGCGTATCAAATTCTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002397.3-1399s21c1
Sequence:CCGGCCCAATGAATTTAGGAATGAACTCGAGTTCATTCCTAAATTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025282
VALIDATED
MEF2C MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000012068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025282.1-1873s1c1
Sequence:CCGGGCCTCAGTGATACAGTATAAACTCGAGTTTATACTGTATCACTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-460s1c1
Sequence:CCGGGCGTAACAGACAGGTGACTTTCTCGAGAAAGTCACCTGTCTGTTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-1214s1c1
Sequence:CCGGCCATCAGTGAATCAAAGGATACTCGAGTATCCTTTGATTCACTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-828s1c1
Sequence:CCGGCCAGCTTTGAGATGCCAGTTACTCGAGTAACTGGCATCTCAAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025282
VALIDATED
MEF2C MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000012068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025282.1-1873s1c1
Sequence:CCGGGCCTCAGTGATACAGTATAAACTCGAGTTTATACTGTATCACTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-460s1c1
Sequence:CCGGGCGTAACAGACAGGTGACTTTCTCGAGAAAGTCACCTGTCTGTTACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-1214s1c1
Sequence:CCGGCCATCAGTGAATCAAAGGATACTCGAGTATCCTTTGATTCACTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-828s1c1
Sequence:CCGGCCAGCTTTGAGATGCCAGTTACTCGAGTAACTGGCATCTCAAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025282
VALIDATED
MEF2C MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000012068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025282.1-1873s1c1
Sequence:CCGGGCCTCAGTGATACAGTATAAACTCGAGTTTATACTGTATCACTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-460s1c1
Sequence:CCGGGCGTAACAGACAGGTGACTTTCTCGAGAAAGTCACCTGTCTGTTACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-1214s1c1
Sequence:CCGGCCATCAGTGAATCAAAGGATACTCGAGTATCCTTTGATTCACTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025282.1-828s1c1
Sequence:CCGGCCAGCTTTGAGATGCCAGTTACTCGAGTAACTGGCATCTCAAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)