EMAIL THIS PAGE TO A FRIEND

MEF2D

myocyte enhancer factor 2D

279 Gene Product Result for
UniProtKB ID: Q14814, D3DVC0, Q14815, Q5T9U5, Q5T9U6
Gene ID:
Human(4209) Summary: This gene is a member of the myocyte-specific enhancer factor 2 (MEF2) family of transcription factors. Members of this family are involved in control of muscle and neuronal cell differentiation and development, and are regulated by class II histone deacetylases. Fusions of the encoded protein with Deleted in Azoospermia-Associated Protein 1 (DAZAP1) due to a translocation have been found in an acute lymphoblastic leukemia cell line, suggesting a role in leukemogenesis. The encoded protein may also be involved in Parkinson disease and myotonic dystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Mouse(17261) myocyte enhancer factor 2D
Rat(81518) myocyte enhancer factor 2D
Zebrafish(30580) myocyte enhancer factor 2d
dog(490413) myocyte enhancer factor 2D
cow(100336730) myocyte enhancer factor 2D
domestic cat(101084418) myocyte enhancer factor 2D
chicken(769067) MADS box transcription enhancer factor 2, polypeptide D (myocyte enhancer factor 2D)
chicken(431059) myocyte enhancer factor 2D
sheep(101108185) myocyte enhancer factor 2D
naked mole-rat(101714292) myocyte enhancer factor 2D
domestic guinea pig(100723951) myocyte enhancer factor 2D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406115 Anti-MEF2D antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1412354 ANTI-MEF2D antibody produced in mouse clone 1B8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412355 ANTI-MEF2D antibody produced in mouse clone 3F8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA004807 Anti-MEF2D antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA007114 Anti-MEF2D antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2105427 Anti-MEF2D antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, horse
western blot pricing
SAB4501861 Anti-MEF2D antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4503938 Anti-phospho-MEF2D (pSer444) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0004209M1 Monoclonal Anti-MEF2D antibody produced in mouse clone 4D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404066 Monoclonal Anti-MEF2D antibody produced in mouse clone 3A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005920 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005920 Rosetta Predictions human pricing
NM_030860 Rosetta Predictions rat pricing
NM_133665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123772 predicted 657
2 SASI_Hs01_00123773 predicted 762
3 SASI_Hs01_00123774 predicted 513
4 SASI_Hs01_00123775 predicted 508
5 SASI_Hs01_00123776 predicted 1246
6 SASI_Hs01_00123777 predicted 469
7 SASI_Hs01_00123778 predicted 1098
8 SASI_Hs01_00123779 predicted 2424
9 SASI_Hs01_00123780 predicted 634
10 SASI_Hs01_00123781 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057714 predicted 1283
2 SASI_Rn02_00264108 predicted 1279
3 SASI_Rn02_00264109 predicted 1248
4 SASI_Rn01_00057715 predicted 810
5 SASI_Rn01_00057716 predicted 572
6 SASI_Rn01_00057717 predicted 1106
7 SASI_Rn01_00057718 predicted 1285
8 SASI_Rn01_00057719 predicted 687
9 SASI_Rn01_00057720 predicted 670
10 SASI_Rn01_00057721 predicted 1281
11 SASI_Rn01_00057712 predicted 583
12 SASI_Rn01_00057713 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197924 predicted 893
2 SASI_Mm01_00197925 predicted 530
3 SASI_Mm01_00197926 predicted 1239
4 SASI_Mm01_00197927 predicted 1233
5 SASI_Mm01_00197928 predicted 648
6 SASI_Mm01_00197929 predicted 1210
7 SASI_Mm02_00338603 predicted 473
8 SASI_Mm01_00197930 predicted 1066
9 SASI_Mm01_00197931 predicted 962
10 SASI_Mm01_00197933 predicted 1122
11 SASI_Mm01_00197932 predicted 1215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133665
VALIDATED
MEF2D MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2D
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-911s21c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1245s21c1
Sequence:CCGGCAAAGGGTTAATGCATCATTTCTCGAGAAATGATGCATTAACCCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1911s21c1
Sequence:CCGGGCTGGATACTTGGACATTAAACTCGAGTTTAATGTCCAAGTATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-2051s21c1
Sequence:CCGGGTCCTGTTGATGGTTACATTTCTCGAGAAATGTAACCATCAACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-964s21c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-932s1c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-406s1c1
Sequence:CCGGGCGAATCACTGATGAACGGAACTCGAGTTCCGTTCATCAGTGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-1093s1c1
Sequence:CCGGCAATGGCAACAGCCTAAACAACTCGAGTTGTTTAGGCTGTTGCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-879s1c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-1640s1c1
Sequence:CCGGCACATCAGCATCAAGTCAGAACTCGAGTTCTGACTTGATGCTGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133665
VALIDATED
MEF2D MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2D
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-911s21c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1245s21c1
Sequence:CCGGCAAAGGGTTAATGCATCATTTCTCGAGAAATGATGCATTAACCCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1911s21c1
Sequence:CCGGGCTGGATACTTGGACATTAAACTCGAGTTTAATGTCCAAGTATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-2051s21c1
Sequence:CCGGGTCCTGTTGATGGTTACATTTCTCGAGAAATGTAACCATCAACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-964s21c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-932s1c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-406s1c1
Sequence:CCGGGCGAATCACTGATGAACGGAACTCGAGTTCCGTTCATCAGTGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-1093s1c1
Sequence:CCGGCAATGGCAACAGCCTAAACAACTCGAGTTGTTTAGGCTGTTGCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-879s1c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-1640s1c1
Sequence:CCGGCACATCAGCATCAAGTCAGAACTCGAGTTCTGACTTGATGCTGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133665
VALIDATED
MEF2D MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2D
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-911s21c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1245s21c1
Sequence:CCGGCAAAGGGTTAATGCATCATTTCTCGAGAAATGATGCATTAACCCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133665.3-1911s21c1
Sequence:CCGGGCTGGATACTTGGACATTAAACTCGAGTTTAATGTCCAAGTATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304479    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-2051s21c1
Sequence:CCGGGTCCTGTTGATGGTTACATTTCTCGAGAAATGTAACCATCAACAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133665.3-964s21c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-932s1c1
Sequence:CCGGGCACTACAGAGAAACAGTGTTCTCGAGAACACTGTTTCTCTGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-406s1c1
Sequence:CCGGGCGAATCACTGATGAACGGAACTCGAGTTCCGTTCATCAGTGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133665.1-1093s1c1
Sequence:CCGGCAATGGCAACAGCCTAAACAACTCGAGTTGTTTAGGCTGTTGCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-879s1c1
Sequence:CCGGCCCTGGTGACATCATCCCTTACTCGAGTAAGGGATGATGTCACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133665.1-1640s1c1
Sequence:CCGGCACATCAGCATCAAGTCAGAACTCGAGTTCTGACTTGATGCTGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005920
VALIDATED
MEF2D MISSION shRNA Bacterial Glycerol Stock
myocyte enhancer factor 2D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1240s21c1
Sequence:CCGGCACTTGACTGAGGACCATTTACTCGAGTAAATGGTCCTCAGTCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1110s21c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1287s21c1
Sequence:CCGGGGTCTCCCAGTCTACTCATTCCTCGAGGAATGAGTAGACTGGGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1327s21c1
Sequence:CCGGTCTGTGGCAACGCCGAGTTTACTCGAGTAAACTCGGCGTTGCCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-2073s21c1
Sequence:CCGGGTCCTGTTGACGGTTACATTTCTCGAGAAATGTAACCGTCAACAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005920.2-5039s1c1
Sequence:CCGGCCTCTGAAGAACTGGGCATTTCTCGAGAAATGCCCAGTTCTTCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1930s1c1
Sequence:CCGGCGGCTTGATACCTGGACATTACTCGAGTAATGTCCAGGTATCAAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005920.2-1424s1c1
Sequence:CCGGCCTCCTTACCAGCCTTTAGTTCTCGAGAACTAAAGGCTGGTAAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-652s1c1
Sequence:CCGGCTGAGGAAGAAGGGCTTCAATCTCGAGATTGAAGCCCTTCTTCCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1110s1c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005920
VALIDATED
MEF2D MISSION shRNA shRNA Plasmid DNA
myocyte enhancer factor 2D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1240s21c1
Sequence:CCGGCACTTGACTGAGGACCATTTACTCGAGTAAATGGTCCTCAGTCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1110s21c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1287s21c1
Sequence:CCGGGGTCTCCCAGTCTACTCATTCCTCGAGGAATGAGTAGACTGGGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1327s21c1
Sequence:CCGGTCTGTGGCAACGCCGAGTTTACTCGAGTAAACTCGGCGTTGCCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-2073s21c1
Sequence:CCGGGTCCTGTTGACGGTTACATTTCTCGAGAAATGTAACCGTCAACAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005920.2-5039s1c1
Sequence:CCGGCCTCTGAAGAACTGGGCATTTCTCGAGAAATGCCCAGTTCTTCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1930s1c1
Sequence:CCGGCGGCTTGATACCTGGACATTACTCGAGTAATGTCCAGGTATCAAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005920.2-1424s1c1
Sequence:CCGGCCTCCTTACCAGCCTTTAGTTCTCGAGAACTAAAGGCTGGTAAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-652s1c1
Sequence:CCGGCTGAGGAAGAAGGGCTTCAATCTCGAGATTGAAGCCCTTCTTCCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1110s1c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005920
VALIDATED
MEF2D MISSION shRNA Lentiviral Transduction Particles
myocyte enhancer factor 2D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1240s21c1
Sequence:CCGGCACTTGACTGAGGACCATTTACTCGAGTAAATGGTCCTCAGTCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1110s21c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005920.2-1287s21c1
Sequence:CCGGGGTCTCCCAGTCTACTCATTCCTCGAGGAATGAGTAGACTGGGAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-1327s21c1
Sequence:CCGGTCTGTGGCAACGCCGAGTTTACTCGAGTAAACTCGGCGTTGCCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005920.2-2073s21c1
Sequence:CCGGGTCCTGTTGACGGTTACATTTCTCGAGAAATGTAACCGTCAACAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005920.2-5039s1c1
Sequence:CCGGCCTCTGAAGAACTGGGCATTTCTCGAGAAATGCCCAGTTCTTCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1930s1c1
Sequence:CCGGCGGCTTGATACCTGGACATTACTCGAGTAATGTCCAGGTATCAAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005920.2-1424s1c1
Sequence:CCGGCCTCCTTACCAGCCTTTAGTTCTCGAGAACTAAAGGCTGGTAAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-652s1c1
Sequence:CCGGCTGAGGAAGAAGGGCTTCAATCTCGAGATTGAAGCCCTTCTTCCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005920.2-1110s1c1
Sequence:CCGGCAACAGCCTAAACAAGGTCATCTCGAGATGACCTTGTTTAGGCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)