EMAIL THIS PAGE TO A FRIEND

MEFV

Mediterranean fever

53 Gene Product Result for
Synonyms: FMF MEF TRIM20
UniProtKB ID: O15553, D3DUC0, F5H0Q3, Q3MJ84, Q96PN4, Q96PN5
Gene ID:
Human(4210) Summary: This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
Mouse(54483) Mediterranean fever
Rat(58923) Mediterranean fever
dog(490041) Mediterranean fever
domestic cat(101096694) Mediterranean fever
domestic guinea pig(100716500) Mediterranean fever
naked mole-rat(101701604) Mediterranean fever
Domestic Rabbit(100345983) Mediterranean fever
sheep(101121821) Mediterranean fever
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019453 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019453 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019453 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000243 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000243 Rosetta Predictions human pricing
NM_031634 Rosetta Predictions rat pricing
NM_019453 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221343 predicted 1734
2 SASI_Hs01_00221344 predicted 1936
3 SASI_Hs01_00221345 predicted 2187
4 SASI_Hs01_00221346 predicted 2436
5 SASI_Hs01_00221347 predicted 2072
6 SASI_Hs01_00221348 predicted 1936
7 SASI_Hs01_00221349 predicted 2331
8 SASI_Hs01_00221350 predicted 741
9 SASI_Hs01_00221351 predicted 754
10 SASI_Hs02_00302157 predicted 2423
11 SASI_Hs01_00221342 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031634 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068879 predicted 755
2 SASI_Rn01_00068880 predicted 702
3 SASI_Rn01_00068881 predicted 935
4 SASI_Rn01_00068882 predicted 2062
5 SASI_Rn01_00068883 predicted 1954
6 SASI_Rn01_00068885 predicted 2269
7 SASI_Rn01_00068886 predicted 2293
8 SASI_Rn02_00264940 predicted 2020
9 SASI_Rn01_00068887 predicted 815
10 SASI_Rn01_00068888 predicted 1971
11 SASI_Rn01_00068884 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154559 predicted 702
2 SASI_Mm01_00154560 predicted 1471
3 SASI_Mm01_00154561 predicted 2121
4 SASI_Mm01_00154562 predicted 719
5 SASI_Mm01_00154563 predicted 2269
6 SASI_Mm01_00154564 predicted 708
7 SASI_Mm01_00154565 predicted 377
8 SASI_Mm01_00154566 predicted 653
9 SASI_Mm01_00154567 predicted 757
10 SASI_Mm01_00154568 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019453
MEFV MISSION shRNA Bacterial Glycerol Stock
Mediterranean fever
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2264s1c1
Sequence:CCGGGCGCTTAAGAACATGCTGTTACTCGAGTAACAGCATGTTCTTAAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1635s1c1
Sequence:CCGGCCACTTGAGAAGCTATACCAACTCGAGTTGGTATAGCTTCTCAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2644s1c1
Sequence:CCGGGCTAGGAGCAACATGGCATATCTCGAGATATGCCATGTTGCTCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2627s1c1
Sequence:CCGGGCTTCCTAAACTACACAGCTACTCGAGTAGCTGTGTAGTTTAGGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1758s1c1
Sequence:CCGGGATGAGATGATTGAAGAACTACTCGAGTAGTTCTTCAATCATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-95s1c1
Sequence:CCGGCTTTGAGAAGTTCAAGTTTAACTCGAGTTAAACTTGAACTTCTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2189s1c1
Sequence:CCGGGATCCATTCTCGGAACAACAACTCGAGTTGTTGTTCCGAGAATGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019453
MEFV MISSION shRNA shRNA Plasmid DNA
Mediterranean fever
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2264s1c1
Sequence:CCGGGCGCTTAAGAACATGCTGTTACTCGAGTAACAGCATGTTCTTAAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1635s1c1
Sequence:CCGGCCACTTGAGAAGCTATACCAACTCGAGTTGGTATAGCTTCTCAAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2644s1c1
Sequence:CCGGGCTAGGAGCAACATGGCATATCTCGAGATATGCCATGTTGCTCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2627s1c1
Sequence:CCGGGCTTCCTAAACTACACAGCTACTCGAGTAGCTGTGTAGTTTAGGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1758s1c1
Sequence:CCGGGATGAGATGATTGAAGAACTACTCGAGTAGTTCTTCAATCATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-95s1c1
Sequence:CCGGCTTTGAGAAGTTCAAGTTTAACTCGAGTTAAACTTGAACTTCTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2189s1c1
Sequence:CCGGGATCCATTCTCGGAACAACAACTCGAGTTGTTGTTCCGAGAATGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019453
MEFV MISSION shRNA Lentiviral Transduction Particles
Mediterranean fever
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2264s1c1
Sequence:CCGGGCGCTTAAGAACATGCTGTTACTCGAGTAACAGCATGTTCTTAAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1635s1c1
Sequence:CCGGCCACTTGAGAAGCTATACCAACTCGAGTTGGTATAGCTTCTCAAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190581    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2644s1c1
Sequence:CCGGGCTAGGAGCAACATGGCATATCTCGAGATATGCCATGTTGCTCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019453.1-2627s1c1
Sequence:CCGGGCTTCCTAAACTACACAGCTACTCGAGTAGCTGTGTAGTTTAGGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-1758s1c1
Sequence:CCGGGATGAGATGATTGAAGAACTACTCGAGTAGTTCTTCAATCATCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-95s1c1
Sequence:CCGGCTTTGAGAAGTTCAAGTTTAACTCGAGTTAAACTTGAACTTCTCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019453.1-2189s1c1
Sequence:CCGGGATCCATTCTCGGAACAACAACTCGAGTTGTTGTTCCGAGAATGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000243
MEFV MISSION shRNA Bacterial Glycerol Stock
Mediterranean fever
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2552s21c1
Sequence:CCGGGAACGAACATGTTAGTCAATCCTCGAGGATTGACTAACATGTTCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1287s1c1
Sequence:CCGGGCCCTGGAACACAAGAAGAAACTCGAGTTTCTTCTTGTGTTCCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-110s1c1
Sequence:CCGGGTTCAAGTTCAAGCTGCAGAACTCGAGTTCTGCAGCTTGAACTTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-2254s1c1
Sequence:CCGGCCCACATCTATACATTCGCCACTCGAGTGGCGAATGTATAGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1892s1c1
Sequence:CCGGGAAGAGTGTTAGACTTGGAAACTCGAGTTTCCAAGTCTAACACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1830s1c1
Sequence:CCGGGCTGTTAATGTGATTCTGGATCTCGAGATCCAGAATCACATTAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2516s21c1
Sequence:CCGGCACGGAGCCTACCCGATTATACTCGAGTATAATCGGGTAGGCTCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2620s21c1
Sequence:CCGGAGTACGGAGTCGTTGCATAATCTCGAGATTATGCAACGACTCCGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000243.2-2043s21c1
Sequence:CCGGGAGCCTGCAAGACATCCATAACTCGAGTTATGGATGTCTTGCAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000243
MEFV MISSION shRNA shRNA Plasmid DNA
Mediterranean fever
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2552s21c1
Sequence:CCGGGAACGAACATGTTAGTCAATCCTCGAGGATTGACTAACATGTTCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1287s1c1
Sequence:CCGGGCCCTGGAACACAAGAAGAAACTCGAGTTTCTTCTTGTGTTCCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-110s1c1
Sequence:CCGGGTTCAAGTTCAAGCTGCAGAACTCGAGTTCTGCAGCTTGAACTTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-2254s1c1
Sequence:CCGGCCCACATCTATACATTCGCCACTCGAGTGGCGAATGTATAGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1892s1c1
Sequence:CCGGGAAGAGTGTTAGACTTGGAAACTCGAGTTTCCAAGTCTAACACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1830s1c1
Sequence:CCGGGCTGTTAATGTGATTCTGGATCTCGAGATCCAGAATCACATTAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2516s21c1
Sequence:CCGGCACGGAGCCTACCCGATTATACTCGAGTATAATCGGGTAGGCTCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2620s21c1
Sequence:CCGGAGTACGGAGTCGTTGCATAATCTCGAGATTATGCAACGACTCCGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000243.2-2043s21c1
Sequence:CCGGGAGCCTGCAAGACATCCATAACTCGAGTTATGGATGTCTTGCAGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000243
MEFV MISSION shRNA Lentiviral Transduction Particles
Mediterranean fever
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421322    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2552s21c1
Sequence:CCGGGAACGAACATGTTAGTCAATCCTCGAGGATTGACTAACATGTTCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1287s1c1
Sequence:CCGGGCCCTGGAACACAAGAAGAAACTCGAGTTTCTTCTTGTGTTCCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-110s1c1
Sequence:CCGGGTTCAAGTTCAAGCTGCAGAACTCGAGTTCTGCAGCTTGAACTTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-2254s1c1
Sequence:CCGGCCCACATCTATACATTCGCCACTCGAGTGGCGAATGTATAGATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1892s1c1
Sequence:CCGGGAAGAGTGTTAGACTTGGAAACTCGAGTTTCCAAGTCTAACACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000243.1-1830s1c1
Sequence:CCGGGCTGTTAATGTGATTCTGGATCTCGAGATCCAGAATCACATTAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2516s21c1
Sequence:CCGGCACGGAGCCTACCCGATTATACTCGAGTATAATCGGGTAGGCTCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000243.2-2620s21c1
Sequence:CCGGAGTACGGAGTCGTTGCATAATCTCGAGATTATGCAACGACTCCGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000243.2-2043s21c1
Sequence:CCGGGAGCCTGCAAGACATCCATAACTCGAGTTATGGATGTCTTGCAGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)