EMAIL THIS PAGE TO A FRIEND

MEG3

maternally expressed 3 (non-protein coding)

211 Gene Product Result for
Synonyms: FP504 GTL2 LINC00023 NCRNA00023 PRO0518 PRO2160 prebp1
UniProtKB ID: Q9UI56
Gene ID:
Mouse(17263) maternally expressed 3
cow(100335527) maternally expressed 3 (non-protein coding)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002766 Rosetta Predictions human pricing
NR_003530 Rosetta Predictions human pricing
NR_003531 Rosetta Predictions human pricing
NM_144513 Rosetta Predictions mouse pricing
NR_003633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376630 predicted 325
2 SASI_Hs02_00376631 predicted 371
3 SASI_Hs02_00376632 predicted 393
4 SASI_Hs02_00376633 predicted 315
5 SASI_Hs02_00376634 predicted 195
6 SASI_Hs02_00376635 predicted 307
7 SASI_Hs02_00376636 predicted 385
8 SASI_Hs02_00376637 predicted 369
9 SASI_Hs02_00376638 predicted 431
10 SASI_Hs02_00376639 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379447 predicted 415
2 SASI_Hs02_00379448 predicted 345
3 SASI_Hs02_00379449 predicted 387
4 SASI_Hs02_00379450 predicted 335
5 SASI_Hs02_00379451 predicted 221
6 SASI_Hs02_00379452 predicted 451
7 SASI_Hs02_00379453 predicted 433
8 SASI_Hs02_00379454 predicted 1272
9 SASI_Hs02_00379455 predicted 1263
10 SASI_Hs02_00379456 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379457 predicted 418
2 SASI_Hs02_00379458 predicted 344
3 SASI_Hs02_00379459 predicted 392
4 SASI_Hs02_00379460 predicted 415
5 SASI_Hs02_00379461 predicted 327
6 SASI_Hs02_00379462 predicted 217
7 SASI_Hs02_00379463 predicted 333
8 SASI_Hs02_00379464 predicted 391
9 SASI_Hs02_00379465 predicted 444
10 SASI_Hs02_00379466 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098760 predicted 1416
2 SASI_Mm01_00098761 predicted 1565
3 SASI_Mm01_00098762 predicted 1305
4 SASI_Mm01_00098763 predicted 1580
5 SASI_Mm01_00098764 predicted 937
6 SASI_Mm01_00098765 predicted 887
7 SASI_Mm01_00098766 predicted 1229
8 SASI_Mm01_00098767 predicted 992
9 SASI_Mm01_00098768 predicted 1267
10 SASI_Mm01_00098769 predicted 1568
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353703 predicted 2702
2 SASI_Mm02_00353704 predicted 3879
3 SASI_Mm02_00353705 predicted 2556
4 SASI_Mm02_00353706 predicted 1571
5 SASI_Mm02_00353707 predicted 3198
6 SASI_Mm02_00353708 predicted 2839
7 SASI_Mm02_00353709 predicted 2473
8 SASI_Mm02_00353710 predicted 1979
9 SASI_Mm02_00353711 predicted 1134
10 SASI_Mm02_00353712 predicted 3528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144513
MEG3 MISSION shRNA Bacterial Glycerol Stock
maternally expressed 3 (non-protein coding)
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000195761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-792s1c1
Sequence:CCGGCCAGTGTCTGTCTTTCCTTCACTCGAGTGAAGGAAAGACAGACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-940s1c1
Sequence:CCGGCTTCCTGTGCCATTTGCTGTTCTCGAGAACAGCAAATGGCACAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144513
MEG3 MISSION shRNA shRNA Plasmid DNA
maternally expressed 3 (non-protein coding)
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000195761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-792s1c1
Sequence:CCGGCCAGTGTCTGTCTTTCCTTCACTCGAGTGAAGGAAAGACAGACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-940s1c1
Sequence:CCGGCTTCCTGTGCCATTTGCTGTTCTCGAGAACAGCAAATGGCACAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144513
MEG3 MISSION shRNA Lentiviral Transduction Particles
maternally expressed 3 (non-protein coding)
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000195761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-792s1c1
Sequence:CCGGCCAGTGTCTGTCTTTCCTTCACTCGAGTGAAGGAAAGACAGACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144513.2-940s1c1
Sequence:CCGGCTTCCTGTGCCATTTGCTGTTCTCGAGAACAGCAAATGGCACAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)