EMAIL THIS PAGE TO A FRIEND

MEGF10

multiple EGF-like-domains 10

155 Gene Product Result for
Synonyms: EMARDD
UniProtKB ID: Q96KG7, Q68DE5, Q8WUL3
Gene ID:
Human(84466) Summary: This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
Mouse(70417) multiple EGF-like-domains 10
Rat(291445) multiple EGF-like domains 10
Zebrafish(564571) multiple EGF-like-domains 10
cow(539136) multiple EGF-like-domains 10
Horse(100063589) multiple EGF-like-domains 10
domestic cat(101087898) multiple EGF-like-domains 10
dog(474665) multiple EGF-like-domains 10
chicken(427126) multiple EGF-like-domains 10
sheep(101106165) multiple EGF-like-domains 10
Domestic Rabbit(100356355) multiple EGF-like-domains 10
naked mole-rat(101707126) multiple EGF-like-domains 10
domestic guinea pig(100730577) multiple EGF-like-domains 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032446 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001979 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001979 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001979 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051631 MISSION® esiRNA esiRNA human MEGF10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032446 Rosetta Predictions human pricing
XM_001059780 Rosetta Predictions rat pricing
XM_238019 Rosetta Predictions rat pricing
NM_001001979 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160625 predicted 3444
2 SASI_Hs02_00359858 predicted 1019
3 SASI_Hs01_00160627 predicted 1587
4 SASI_Hs01_00160628 predicted 2673
5 SASI_Hs01_00160629 predicted 2628
6 SASI_Hs01_00160630 predicted 1557
7 SASI_Hs01_00160631 predicted 1299
8 SASI_Hs01_00160632 predicted 3097
9 SASI_Hs01_00160633 predicted 2795
10 SASI_Hs01_00160634 predicted 2729
11 SASI_Hs01_00160626 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294320 predicted 2524
2 SASI_Rn02_00294321 predicted 2795
3 SASI_Rn02_00294322 predicted 2795
4 SASI_Rn02_00294323 predicted 2366
5 SASI_Rn02_00294324 predicted 288
6 SASI_Rn02_00294325 predicted 3179
7 SASI_Rn02_00294326 predicted 2088
8 SASI_Rn02_00294327 predicted 2858
9 SASI_Rn02_00294328 predicted 3183
10 SASI_Rn02_00294329 predicted 2118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_238019 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391146 predicted 2481
2 SASI_Rn02_00391147 predicted 3074
3 SASI_Rn02_00391148 predicted 2743
4 SASI_Rn02_00391149 predicted 2743
5 SASI_Rn02_00391150 predicted 2312
6 SASI_Rn02_00391151 predicted 245
7 SASI_Rn02_00391152 predicted 2042
8 SASI_Rn02_00391153 predicted 2813
9 SASI_Rn02_00391154 predicted 2068
10 SASI_Rn02_00391155 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180085 predicted 2325
2 SASI_Mm01_00180086 predicted 2538
3 SASI_Mm01_00180087 predicted 267
4 SASI_Mm02_00286238 predicted 369
5 SASI_Mm01_00180088 predicted 2299
6 SASI_Mm01_00180089 predicted 844
7 SASI_Mm01_00180090 predicted 3035
8 SASI_Mm01_00180091 predicted 3082
9 SASI_Mm01_00180092 predicted 3351
10 SASI_Mm01_00180093 predicted 1746
11 SASI_Mm01_00180094 predicted 2612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032446
MEGF10 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-376s1c1
Sequence:CCGGCGAGCTGCACTGACATTCTAACTCGAGTTAGAATGTCAGTGCAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-3387s1c1
Sequence:CCGGGCAGAGATCAATAACTCAACTCTCGAGAGTTGAGTTATTGATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-1678s1c1
Sequence:CCGGGCTTTGGCTGTAACTTAACATCTCGAGATGTTAAGTTACAGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2817s1c1
Sequence:CCGGCTACTGGCATTGTTCATTATTCTCGAGAATAATGAACAATGCCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-455s1c1
Sequence:CCGGGAAGACTATGTATAGGCGCAACTCGAGTTGCGCCTATACATAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2947s1c1
Sequence:CCGGGCAATGGTGGAAACGCTAATACTCGAGTATTAGCGTTTCCACCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2746s21c1
Sequence:CCGGGCTATGGCTGTCGCCAGATATCTCGAGATATCTGGCGACAGCCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032446.2-3867s21c1
Sequence:CCGGTCATGTGAATGTTAGTCAATTCTCGAGAATTGACTAACATTCACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-3061s21c1
Sequence:CCGGGGGTCGTCAATGCAGATTATACTCGAGTATAATCTGCATTGACGACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2653s21c1
Sequence:CCGGGAGCTGACTGCGACCACATTTCTCGAGAAATGTGGTCGCAGTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032446
MEGF10 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-376s1c1
Sequence:CCGGCGAGCTGCACTGACATTCTAACTCGAGTTAGAATGTCAGTGCAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-3387s1c1
Sequence:CCGGGCAGAGATCAATAACTCAACTCTCGAGAGTTGAGTTATTGATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-1678s1c1
Sequence:CCGGGCTTTGGCTGTAACTTAACATCTCGAGATGTTAAGTTACAGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2817s1c1
Sequence:CCGGCTACTGGCATTGTTCATTATTCTCGAGAATAATGAACAATGCCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-455s1c1
Sequence:CCGGGAAGACTATGTATAGGCGCAACTCGAGTTGCGCCTATACATAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2947s1c1
Sequence:CCGGGCAATGGTGGAAACGCTAATACTCGAGTATTAGCGTTTCCACCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2746s21c1
Sequence:CCGGGCTATGGCTGTCGCCAGATATCTCGAGATATCTGGCGACAGCCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032446.2-3867s21c1
Sequence:CCGGTCATGTGAATGTTAGTCAATTCTCGAGAATTGACTAACATTCACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-3061s21c1
Sequence:CCGGGGGTCGTCAATGCAGATTATACTCGAGTATAATCTGCATTGACGACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2653s21c1
Sequence:CCGGGAGCTGACTGCGACCACATTTCTCGAGAAATGTGGTCGCAGTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032446
MEGF10 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-376s1c1
Sequence:CCGGCGAGCTGCACTGACATTCTAACTCGAGTTAGAATGTCAGTGCAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-3387s1c1
Sequence:CCGGGCAGAGATCAATAACTCAACTCTCGAGAGTTGAGTTATTGATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-1678s1c1
Sequence:CCGGGCTTTGGCTGTAACTTAACATCTCGAGATGTTAAGTTACAGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2817s1c1
Sequence:CCGGCTACTGGCATTGTTCATTATTCTCGAGAATAATGAACAATGCCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-455s1c1
Sequence:CCGGGAAGACTATGTATAGGCGCAACTCGAGTTGCGCCTATACATAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032446.1-2947s1c1
Sequence:CCGGGCAATGGTGGAAACGCTAATACTCGAGTATTAGCGTTTCCACCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2746s21c1
Sequence:CCGGGCTATGGCTGTCGCCAGATATCTCGAGATATCTGGCGACAGCCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032446.2-3867s21c1
Sequence:CCGGTCATGTGAATGTTAGTCAATTCTCGAGAATTGACTAACATTCACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-3061s21c1
Sequence:CCGGGGGTCGTCAATGCAGATTATACTCGAGTATAATCTGCATTGACGACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032446.2-2653s21c1
Sequence:CCGGGAGCTGACTGCGACCACATTTCTCGAGAAATGTGGTCGCAGTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001979
MEGF10 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001979.1-4806s1c1
Sequence:CCGGCGGAATTATGATGTGTCCATTCTCGAGAATGGACACATCATAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2983s1c1
Sequence:CCGGGCAGACTATACCATCGCAGAACTCGAGTTCTGCGATGGTATAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-1613s1c1
Sequence:CCGGGCTACGGGATAAATTGTTCTTCTCGAGAAGAACAATTTATCCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2286s1c1
Sequence:CCGGCGTTTGTACTTGCACCAACAACTCGAGTTGTTGGTGCAAGTACAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-3578s1c1
Sequence:CCGGCAAAGAACAGTCACATCCCTTCTCGAGAAGGGATGTGACTGTTCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001979
MEGF10 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001979.1-4806s1c1
Sequence:CCGGCGGAATTATGATGTGTCCATTCTCGAGAATGGACACATCATAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2983s1c1
Sequence:CCGGGCAGACTATACCATCGCAGAACTCGAGTTCTGCGATGGTATAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-1613s1c1
Sequence:CCGGGCTACGGGATAAATTGTTCTTCTCGAGAAGAACAATTTATCCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2286s1c1
Sequence:CCGGCGTTTGTACTTGCACCAACAACTCGAGTTGTTGGTGCAAGTACAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-3578s1c1
Sequence:CCGGCAAAGAACAGTCACATCCCTTCTCGAGAAGGGATGTGACTGTTCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001979
MEGF10 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001979.1-4806s1c1
Sequence:CCGGCGGAATTATGATGTGTCCATTCTCGAGAATGGACACATCATAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2983s1c1
Sequence:CCGGGCAGACTATACCATCGCAGAACTCGAGTTCTGCGATGGTATAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-1613s1c1
Sequence:CCGGGCTACGGGATAAATTGTTCTTCTCGAGAAGAACAATTTATCCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-2286s1c1
Sequence:CCGGCGTTTGTACTTGCACCAACAACTCGAGTTGTTGGTGCAAGTACAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001979.1-3578s1c1
Sequence:CCGGCAAAGAACAGTCACATCCCTTCTCGAGAAGGGATGTGACTGTTCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)