EMAIL THIS PAGE TO A FRIEND

MEGF11

multiple EGF-like-domains 11

170 Gene Product Result for
UniProtKB ID: A6BM72, Q17R86, Q6UXS5, Q8ND91, Q96KG6
Gene ID:
Mouse(214058) multiple EGF-like-domains 11
Rat(691517) multiple EGF-like-domains 11
domestic guinea pig(100719939) multiple EGF-like-domains 11
naked mole-rat(101718485) multiple EGF-like-domains 11
Domestic Rabbit(100342064) multiple EGF-like-domains 11
sheep(101123125) multiple EGF-like-domains 11
Zebrafish(563468) multiple EGF-like-domains 11
domestic cat(101082158) multiple EGF-like-domains 11
cow(100336680) multiple EGF-like-domains 11
cow(512483) multiple EGF-like-domains 11
dog(487609) multiple EGF-like-domains 11
chicken(415545) multiple EGF-like-domains 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032445 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016811 MISSION® esiRNA esiRNA targeting mouse Megf11 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032445 Rosetta Predictions human pricing
XM_001078620 Rosetta Predictions rat pricing
NM_172522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030559 predicted 3139
2 SASI_Hs01_00030560 predicted 3189
3 SASI_Hs01_00030564 predicted 2700
4 SASI_Hs01_00030562 predicted 1259
5 SASI_Hs01_00030566 predicted 3129
6 SASI_Hs01_00030567 predicted 2870
7 SASI_Hs01_00030568 predicted 1010
8 SASI_Hs02_00359855 predicted 3329
9 SASI_Hs02_00359856 predicted 3172
10 SASI_Hs02_00359857 predicted 410
11 SASI_Hs01_00030561 predicted 2312
12 SASI_Hs01_00030563 predicted 3052
13 SASI_Hs01_00030565 predicted 2950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078620 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361487 predicted 2551
2 SASI_Rn02_00361488 predicted 2420
3 SASI_Rn02_00361489 predicted 2472
4 SASI_Rn02_00361490 predicted 2617
5 SASI_Rn02_00361491 predicted 2405
6 SASI_Rn02_00361492 predicted 2730
7 SASI_Rn02_00361493 predicted 570
8 SASI_Rn02_00361494 predicted 2461
9 SASI_Rn02_00361495 predicted 540
10 SASI_Rn02_00361496 predicted 2863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136096 predicted 414
2 SASI_Mm01_00136097 predicted 1018
3 SASI_Mm01_00136098 predicted 2219
4 SASI_Mm01_00136099 predicted 1371
5 SASI_Mm01_00136100 predicted 1871
6 SASI_Mm01_00136101 predicted 2863
7 SASI_Mm01_00136102 predicted 2611
8 SASI_Mm01_00136103 predicted 2946
9 SASI_Mm01_00136104 predicted 1154
10 SASI_Mm01_00136105 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172522
MEGF11 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172522.1-3017s1c1
Sequence:CCGGGCCAGCTAAATGTCTTCAGAACTCGAGTTCTGAAGACATTTAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1237s1c1
Sequence:CCGGCCGGCTACTATGGCAACGGTTCTCGAGAACCGTTGCCATAGTAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1853s1c1
Sequence:CCGGAGGACCCTTATGTCAGAGAATCTCGAGATTCTCTGACATAAGGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2303s1c1
Sequence:CCGGGCTATGTGAGTGCATGAACAACTCGAGTTGTTCATGCACTCACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2945s1c1
Sequence:CCGGGAACACATACATTATGGACAACTCGAGTTGTCCATAATGTATGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172522
MEGF11 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172522.1-3017s1c1
Sequence:CCGGGCCAGCTAAATGTCTTCAGAACTCGAGTTCTGAAGACATTTAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1237s1c1
Sequence:CCGGCCGGCTACTATGGCAACGGTTCTCGAGAACCGTTGCCATAGTAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1853s1c1
Sequence:CCGGAGGACCCTTATGTCAGAGAATCTCGAGATTCTCTGACATAAGGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2303s1c1
Sequence:CCGGGCTATGTGAGTGCATGAACAACTCGAGTTGTTCATGCACTCACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2945s1c1
Sequence:CCGGGAACACATACATTATGGACAACTCGAGTTGTCCATAATGTATGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172522
MEGF11 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119472    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172522.1-3017s1c1
Sequence:CCGGGCCAGCTAAATGTCTTCAGAACTCGAGTTCTGAAGACATTTAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1237s1c1
Sequence:CCGGCCGGCTACTATGGCAACGGTTCTCGAGAACCGTTGCCATAGTAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-1853s1c1
Sequence:CCGGAGGACCCTTATGTCAGAGAATCTCGAGATTCTCTGACATAAGGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2303s1c1
Sequence:CCGGGCTATGTGAGTGCATGAACAACTCGAGTTGTTCATGCACTCACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172522.1-2945s1c1
Sequence:CCGGGAACACATACATTATGGACAACTCGAGTTGTCCATAATGTATGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032445
MEGF11 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1986s1c1
Sequence:CCGGCTTTCCTGGATGGATTGGCAACTCGAGTTGCCAATCCATCCAGGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2928s1c1
Sequence:CCGGCCAAGAAGGTTGCGGTCATAACTCGAGTTATGACCGCAACCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2813s1c1
Sequence:CCGGGCAGCTATGTAGAAATGAAGTCTCGAGACTTCATTTCTACATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032445.1-3600s1c1
Sequence:CCGGCCATCAAATTACAACAGCCAACTCGAGTTGGCTGTTGTAATTTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1275s1c1
Sequence:CCGGGTCCATCTGTAGCTGTAACAACTCGAGTTGTTACAGCTACAGATGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2951s1c1
Sequence:CCGGCCAGCTATATCCAGAATGCATCTCGAGATGCATTCTGGATATAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2868s1c1
Sequence:CCGGGCCATCCTTGTCGACATCTAACTCGAGTTAGATGTCGACAAGGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-2427s1c1
Sequence:CCGGGCTGAATCCCTACACCAAGATCTCGAGATCTTGGTGTAGGGATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032445
MEGF11 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1986s1c1
Sequence:CCGGCTTTCCTGGATGGATTGGCAACTCGAGTTGCCAATCCATCCAGGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2928s1c1
Sequence:CCGGCCAAGAAGGTTGCGGTCATAACTCGAGTTATGACCGCAACCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2813s1c1
Sequence:CCGGGCAGCTATGTAGAAATGAAGTCTCGAGACTTCATTTCTACATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032445.1-3600s1c1
Sequence:CCGGCCATCAAATTACAACAGCCAACTCGAGTTGGCTGTTGTAATTTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1275s1c1
Sequence:CCGGGTCCATCTGTAGCTGTAACAACTCGAGTTGTTACAGCTACAGATGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2951s1c1
Sequence:CCGGCCAGCTATATCCAGAATGCATCTCGAGATGCATTCTGGATATAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2868s1c1
Sequence:CCGGGCCATCCTTGTCGACATCTAACTCGAGTTAGATGTCGACAAGGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-2427s1c1
Sequence:CCGGGCTGAATCCCTACACCAAGATCTCGAGATCTTGGTGTAGGGATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032445
MEGF11 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1986s1c1
Sequence:CCGGCTTTCCTGGATGGATTGGCAACTCGAGTTGCCAATCCATCCAGGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2928s1c1
Sequence:CCGGCCAAGAAGGTTGCGGTCATAACTCGAGTTATGACCGCAACCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2813s1c1
Sequence:CCGGGCAGCTATGTAGAAATGAAGTCTCGAGACTTCATTTCTACATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032445.1-3600s1c1
Sequence:CCGGCCATCAAATTACAACAGCCAACTCGAGTTGGCTGTTGTAATTTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-1275s1c1
Sequence:CCGGGTCCATCTGTAGCTGTAACAACTCGAGTTGTTACAGCTACAGATGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2951s1c1
Sequence:CCGGCCAGCTATATCCAGAATGCATCTCGAGATGCATTCTGGATATAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032445.1-2868s1c1
Sequence:CCGGGCCATCCTTGTCGACATCTAACTCGAGTTAGATGTCGACAAGGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032445.1-2427s1c1
Sequence:CCGGGCTGAATCCCTACACCAAGATCTCGAGATCTTGGTGTAGGGATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)