EMAIL THIS PAGE TO A FRIEND

MEGF6

multiple EGF-like-domains 6

118 Gene Product Result for
Synonyms: EGFL3
UniProtKB ID: O75095, Q4AC86, Q5VV39
Gene ID:
Mouse(230971) multiple EGF-like-domains 6
Rat(65049) multiple EGF-like-domains 6
chicken(419385) multiple EGF-like-domains 6
cow(616459) multiple EGF-like-domains 6
dog(489619) multiple EGF-like-domains 6
Horse(100060730) multiple EGF-like-domains 6
domestic cat(101091126) multiple EGF-like-domains 6
sheep(101119490) multiple EGF-like-domains 6
naked mole-rat(101719337) multiple EGF-like-domains 6
domestic guinea pig(101788995) multiple EGF-like-domains 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_031401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_031401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_031401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001162977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001162977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001162977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001409 Rosetta Predictions human pricing
XM_927400 Rosetta Predictions human pricing
NM_022955 Rosetta Predictions rat pricing
XM_579474 Rosetta Predictions rat pricing
XM_001004032 Rosetta Predictions mouse pricing
XM_001004037 Rosetta Predictions mouse pricing
XM_001004041 Rosetta Predictions mouse pricing
XM_620148 Rosetta Predictions mouse pricing
XM_902453 Rosetta Predictions mouse pricing
XM_909777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092747 predicted 1203
2 SASI_Hs01_00092748 predicted 4601
3 SASI_Hs01_00092749 predicted 693
4 SASI_Hs01_00092750 predicted 479
5 SASI_Hs01_00092751 predicted 1379
6 SASI_Hs01_00092753 predicted 3130
7 SASI_Hs01_00092755 predicted 711
8 SASI_Hs02_00331794 predicted 2941
9 SASI_Hs02_00331795 predicted 597
10 SASI_Hs01_00092756 predicted 1160
11 SASI_Hs01_00092752 predicted 3361
12 SASI_Hs01_00092754 predicted 4627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287039 predicted 2870
2 SASI_Hs01_00287040 predicted 1452
3 SASI_Hs01_00287041 predicted 1911
4 SASI_Hs01_00287042 predicted 4000
5 SASI_Hs01_00287043 predicted 5302
6 SASI_Hs01_00287044 predicted 1350
7 SASI_Hs01_00287045 predicted 4422
8 SASI_Hs01_00287046 predicted 1884
9 SASI_Hs01_00287047 predicted 3350
10 SASI_Hs01_00287048 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050036 predicted 987
2 SASI_Rn01_00050037 predicted 2048
3 SASI_Rn01_00050038 predicted 2919
4 SASI_Rn01_00050039 predicted 4469
5 SASI_Rn01_00050040 predicted 1340
6 SASI_Rn01_00050041 predicted 1201
7 SASI_Rn01_00050042 predicted 1884
8 SASI_Rn01_00050043 predicted 1757
9 SASI_Rn01_00050044 predicted 1684
10 SASI_Rn01_00050045 predicted 3821
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00160248 predicted 1731
2 SASI_Rn01_00160249 predicted 1934
3 SASI_Rn01_00160250 predicted 1336
4 SASI_Rn01_00160251 predicted 1345
5 SASI_Rn01_00160252 predicted 1586
6 SASI_Rn01_00160253 predicted 1584
7 SASI_Rn01_00160254 predicted 2052
8 SASI_Rn01_00160255 predicted 1338
9 SASI_Rn01_00160256 predicted 1327
10 SASI_Rn01_00160257 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004032 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269428 predicted 3873
2 SASI_Mm01_00269429 predicted 4950
3 SASI_Mm01_00269430 predicted 5013
4 SASI_Mm01_00269431 predicted 4902
5 SASI_Mm01_00269432 predicted 5003
6 SASI_Mm01_00269433 predicted 4878
7 SASI_Mm01_00269434 predicted 3934
8 SASI_Mm01_00269435 predicted 4193
9 SASI_Mm01_00269436 predicted 4136
10 SASI_Mm01_00269437 predicted 4962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004037 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00217395 predicted 3578
2 SASI_Mm01_00217396 predicted 4652
3 SASI_Mm01_00217397 predicted 4728
4 SASI_Mm01_00217398 predicted 4605
5 SASI_Mm01_00217399 predicted 4714
6 SASI_Mm01_00217400 predicted 4585
7 SASI_Mm01_00217401 predicted 3641
8 SASI_Mm01_00217402 predicted 3898
9 SASI_Mm01_00217403 predicted 3843
10 SASI_Mm01_00217404 predicted 4661
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215147 predicted 3227
2 SASI_Mm01_00215148 predicted 4301
3 SASI_Mm01_00215149 predicted 4376
4 SASI_Mm01_00215150 predicted 4254
5 SASI_Mm01_00215151 predicted 4362
6 SASI_Mm01_00215152 predicted 4224
7 SASI_Mm01_00215153 predicted 3286
8 SASI_Mm01_00215154 predicted 3542
9 SASI_Mm01_00215155 predicted 3490
10 SASI_Mm01_00215156 predicted 4314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_620148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230448 predicted 4012
2 SASI_Mm01_00230450 predicted 5158
3 SASI_Mm01_00230451 predicted 5036
4 SASI_Mm01_00230452 predicted 5140
5 SASI_Mm02_00427590 predicted 4085
6 SASI_Mm01_00230453 predicted 5015
7 SASI_Mm02_00427591 predicted 4369
8 SASI_Mm01_00230454 predicted 4066
9 SASI_Mm01_00230455 predicted 4327
10 SASI_Mm01_00230456 predicted 4273
11 SASI_Mm01_00230449 predicted 5083
12 SASI_Mm01_00230457 predicted 5101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234524 predicted 1063
2 SASI_Mm01_00234525 predicted 2132
3 SASI_Mm01_00234526 predicted 2200
4 SASI_Mm01_00234527 predicted 2092
5 SASI_Mm01_00234528 predicted 2194
6 SASI_Mm01_00234529 predicted 2063
7 SASI_Mm01_00234530 predicted 1113
8 SASI_Mm01_00234531 predicted 1375
9 SASI_Mm01_00234532 predicted 1318
10 SASI_Mm01_00234533 predicted 2141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435079 predicted 3440
2 SASI_Mm02_00435080 predicted 1283
3 SASI_Mm02_00435081 predicted 797
4 SASI_Mm02_00435082 predicted 563
5 SASI_Mm02_00435083 predicted 811
6 SASI_Mm02_00435084 predicted 2998
7 SASI_Mm02_00435085 predicted 1758
8 SASI_Mm02_00435086 predicted 2274
9 SASI_Mm02_00435087 predicted 2127
10 SASI_Mm02_00435088 predicted 3599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_031401
MEGF6 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-1407s1c1
Sequence:CCGGGAGAAGTTTGTCTGCCTGGATCTCGAGATCCAGGCAGACAAACTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-604s1c1
Sequence:CCGGGCAGGCATTGTGTCCGTAGAACTCGAGTTCTACGGACACAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2452s1c1
Sequence:CCGGGCTGCCAGAGAGCCTGTGATACTCGAGTATCACAGGCTCTCTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-733s1c1
Sequence:CCGGCCTGTGAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2784s1c1
Sequence:CCGGGCTGCCTGTGATGCCGTGAATCTCGAGATTCACGGCATCACAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_031401
MEGF6 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-1407s1c1
Sequence:CCGGGAGAAGTTTGTCTGCCTGGATCTCGAGATCCAGGCAGACAAACTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-604s1c1
Sequence:CCGGGCAGGCATTGTGTCCGTAGAACTCGAGTTCTACGGACACAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2452s1c1
Sequence:CCGGGCTGCCAGAGAGCCTGTGATACTCGAGTATCACAGGCTCTCTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-733s1c1
Sequence:CCGGCCTGTGAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2784s1c1
Sequence:CCGGGCTGCCTGTGATGCCGTGAATCTCGAGATTCACGGCATCACAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_031401
MEGF6 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-1407s1c1
Sequence:CCGGGAGAAGTTTGTCTGCCTGGATCTCGAGATCCAGGCAGACAAACTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-604s1c1
Sequence:CCGGGCAGGCATTGTGTCCGTAGAACTCGAGTTCTACGGACACAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2452s1c1
Sequence:CCGGGCTGCCAGAGAGCCTGTGATACTCGAGTATCACAGGCTCTCTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-733s1c1
Sequence:CCGGCCTGTGAAGATGTGGACGAATCTCGAGATTCGTCCACATCTTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_031401.7-2784s1c1
Sequence:CCGGGCTGCCTGTGATGCCGTGAATCTCGAGATTCACGGCATCACAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001162977
MEGF6 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-2128s21c1
Sequence:CCGGGCAAACACTGTCGTAAGAAATCTCGAGATTTCTTACGACAGTGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-3447s21c1
Sequence:CCGGCATTCCTGTCTCTGCCGAAATCTCGAGATTTCGGCAGAGACAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162977.1-5161s21c1
Sequence:CCGGCAGCTATGGATAGTCATATAGCTCGAGCTATATGACTATCCATAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-4081s21c1
Sequence:CCGGGGCCAGGCTGTGAACAAATTTCTCGAGAAATTTGTTCACAGCCTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-560s21c1
Sequence:CCGGGCGCAGGACTGTGTACTATATCTCGAGATATAGTACACAGTCCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001162977
MEGF6 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-2128s21c1
Sequence:CCGGGCAAACACTGTCGTAAGAAATCTCGAGATTTCTTACGACAGTGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-3447s21c1
Sequence:CCGGCATTCCTGTCTCTGCCGAAATCTCGAGATTTCGGCAGAGACAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162977.1-5161s21c1
Sequence:CCGGCAGCTATGGATAGTCATATAGCTCGAGCTATATGACTATCCATAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-4081s21c1
Sequence:CCGGGGCCAGGCTGTGAACAAATTTCTCGAGAAATTTGTTCACAGCCTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-560s21c1
Sequence:CCGGGCGCAGGACTGTGTACTATATCTCGAGATATAGTACACAGTCCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001162977
MEGF6 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-2128s21c1
Sequence:CCGGGCAAACACTGTCGTAAGAAATCTCGAGATTTCTTACGACAGTGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-3447s21c1
Sequence:CCGGCATTCCTGTCTCTGCCGAAATCTCGAGATTTCGGCAGAGACAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339388    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001162977.1-5161s21c1
Sequence:CCGGCAGCTATGGATAGTCATATAGCTCGAGCTATATGACTATCCATAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-4081s21c1
Sequence:CCGGGGCCAGGCTGTGAACAAATTTCTCGAGAAATTTGTTCACAGCCTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001162977.1-560s21c1
Sequence:CCGGGCGCAGGACTGTGTACTATATCTCGAGATATAGTACACAGTCCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)