EMAIL THIS PAGE TO A FRIEND

MEGF9

multiple EGF-like-domains 9

275 Gene Product Result for
Synonyms: EGFL5
UniProtKB ID: Q9H1U4, B7Z315, O75098
Gene ID:
Mouse(230316) multiple EGF-like-domains 9
Rat(313270) multiple EGF-like-domains 9
sheep(101116545) multiple EGF-like-domains 9
naked mole-rat(101712969) multiple EGF-like-domains 9
domestic guinea pig(100734120) multiple EGF-like-domains 9
chicken(430373) multiple EGF-like-domains 9
dog(481698) multiple EGF-like-domains 9
cow(533820) multiple EGF-like-domains 9
domestic cat(100151765) multiple EGF-like-domains 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172694 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172694 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172694 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080497 Rosetta Predictions human pricing
XM_376905 Rosetta Predictions human pricing
XM_929502 Rosetta Predictions human pricing
XM_933704 Rosetta Predictions human pricing
NM_001107940 Rosetta Predictions rat pricing
NM_172694 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315415 predicted 1372
2 SASI_Hs02_00315416 predicted 1847
3 SASI_Hs02_00315417 predicted 1979
4 SASI_Hs02_00315418 predicted 1631
5 SASI_Hs02_00315419 predicted 925
6 SASI_Hs02_00315420 predicted 711
7 SASI_Hs02_00315421 predicted 660
8 SASI_Hs02_00315422 predicted 1626
9 SASI_Hs02_00315423 predicted 707
10 SASI_Hs02_00315424 predicted 1912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284836 predicted 283
2 SASI_Hs01_00284837 predicted 349
3 SASI_Hs01_00284838 predicted 603
4 SASI_Hs01_00284839 predicted 302
5 SASI_Hs01_00284840 predicted 203
6 SASI_Hs01_00284841 predicted 606
7 SASI_Hs01_00284842 predicted 461
8 SASI_Hs01_00284843 predicted 389
9 SASI_Hs01_00284844 predicted 613
10 SASI_Hs01_00284845 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281169 predicted 512
2 SASI_Hs01_00281170 predicted 665
3 SASI_Hs01_00281171 predicted 508
4 SASI_Hs01_00281172 predicted 390
5 SASI_Hs01_00281173 predicted 407
6 SASI_Hs01_00281174 predicted 403
7 SASI_Hs01_00281175 predicted 513
8 SASI_Hs01_00281176 predicted 500
9 SASI_Hs01_00281177 predicted 504
10 SASI_Hs01_00281178 predicted 460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258259 predicted 1322
2 SASI_Hs01_00258260 predicted 1254
3 SASI_Hs01_00258261 predicted 1219
4 SASI_Hs01_00258262 predicted 1218
5 SASI_Hs01_00258263 predicted 1352
6 SASI_Hs01_00258264 predicted 691
7 SASI_Hs01_00258265 predicted 725
8 SASI_Hs01_00258266 predicted 678
9 SASI_Hs01_00258267 predicted 1217
10 SASI_Hs01_00258268 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107940 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233785 predicted 1243
2 SASI_Rn02_00233786 predicted 1691
3 SASI_Rn02_00233787 predicted 1837
4 SASI_Rn02_00233788 predicted 1798
5 SASI_Rn02_00233789 predicted 952
6 SASI_Rn02_00233790 predicted 2065
7 SASI_Rn02_00233791 predicted 1879
8 SASI_Rn02_00233792 predicted 1037
9 SASI_Rn02_00233793 predicted 1513
10 SASI_Rn02_00233794 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172694 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151658 predicted 1999
2 SASI_Mm01_00151659 predicted 1016
3 SASI_Mm02_00344440 predicted 888
4 SASI_Mm01_00151660 predicted 1171
5 SASI_Mm01_00151661 predicted 1566
6 SASI_Mm01_00151662 predicted 1702
7 SASI_Mm02_00344441 predicted 1728
8 SASI_Mm01_00151663 predicted 966
9 SASI_Mm01_00151665 predicted 1409
10 SASI_Mm02_00344442 predicted 1837
11 SASI_Mm01_00151664 predicted 1770
12 SASI_Mm01_00151666 predicted 2000
13 SASI_Mm01_00151667 predicted 1451
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172694
MEGF9 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-1560s21c1
Sequence:CCGGCAACCCTGCAGACTATCTTTGCTCGAGCAAAGATAGTCTGCAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-724s21c1
Sequence:CCGGGGTTGGAAGTTTGGATGTAAACTCGAGTTTACATCCAAACTTCCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172694.1-2050s1c1
Sequence:CCGGGCCTGTCTGTTGCTCTTAATTCTCGAGAATTAAGAGCAACAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1876s1c1
Sequence:CCGGCCCTGACAACACCTATTCATACTCGAGTATGAATAGGTGTTGTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1376s1c1
Sequence:CCGGCCTTCATAACACCACTGGGTTCTCGAGAACCCAGTGGTGTTATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-906s1c1
Sequence:CCGGTCTGGGAATTGCCAATGCAAACTCGAGTTTGCATTGGCAATTCCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1633s1c1
Sequence:CCGGCCCAGTTTAACATCATCATTTCTCGAGAAATGATGATGTTAAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172694
MEGF9 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-1560s21c1
Sequence:CCGGCAACCCTGCAGACTATCTTTGCTCGAGCAAAGATAGTCTGCAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-724s21c1
Sequence:CCGGGGTTGGAAGTTTGGATGTAAACTCGAGTTTACATCCAAACTTCCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172694.1-2050s1c1
Sequence:CCGGGCCTGTCTGTTGCTCTTAATTCTCGAGAATTAAGAGCAACAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1876s1c1
Sequence:CCGGCCCTGACAACACCTATTCATACTCGAGTATGAATAGGTGTTGTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1376s1c1
Sequence:CCGGCCTTCATAACACCACTGGGTTCTCGAGAACCCAGTGGTGTTATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-906s1c1
Sequence:CCGGTCTGGGAATTGCCAATGCAAACTCGAGTTTGCATTGGCAATTCCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1633s1c1
Sequence:CCGGCCCAGTTTAACATCATCATTTCTCGAGAAATGATGATGTTAAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172694
MEGF9 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-1560s21c1
Sequence:CCGGCAACCCTGCAGACTATCTTTGCTCGAGCAAAGATAGTCTGCAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172694.2-724s21c1
Sequence:CCGGGGTTGGAAGTTTGGATGTAAACTCGAGTTTACATCCAAACTTCCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094589    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172694.1-2050s1c1
Sequence:CCGGGCCTGTCTGTTGCTCTTAATTCTCGAGAATTAAGAGCAACAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1876s1c1
Sequence:CCGGCCCTGACAACACCTATTCATACTCGAGTATGAATAGGTGTTGTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1376s1c1
Sequence:CCGGCCTTCATAACACCACTGGGTTCTCGAGAACCCAGTGGTGTTATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-906s1c1
Sequence:CCGGTCTGGGAATTGCCAATGCAAACTCGAGTTTGCATTGGCAATTCCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172694.1-1633s1c1
Sequence:CCGGCCCAGTTTAACATCATCATTTCTCGAGAAATGATGATGTTAAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080497
VALIDATED
MEGF9 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 9
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000307671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1202s21c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1814s21c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1446s21c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080497.1-1253s21c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080497
VALIDATED
MEGF9 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 9
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000307671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1202s21c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1814s21c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1446s21c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080497.1-1253s21c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080497
VALIDATED
MEGF9 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 9
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000307671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1202s21c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1814s21c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080497.1-1446s21c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001080497.1-1253s21c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376905
VALIDATED
MEGF9 MISSION shRNA Bacterial Glycerol Stock
multiple EGF-like-domains 9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1409s1c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-2021s1c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-878s1c1
Sequence:CCGGCCCGCATAGTACCTCCTTCAACTCGAGTTGAAGGAGGTACTATGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376905.1-1653s1c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1460s1c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376905
VALIDATED
MEGF9 MISSION shRNA shRNA Plasmid DNA
multiple EGF-like-domains 9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1409s1c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-2021s1c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-878s1c1
Sequence:CCGGCCCGCATAGTACCTCCTTCAACTCGAGTTGAAGGAGGTACTATGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376905.1-1653s1c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1460s1c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376905
VALIDATED
MEGF9 MISSION shRNA Lentiviral Transduction Particles
multiple EGF-like-domains 9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1409s1c1
Sequence:CCGGCGAGTGAATTGGAACCTGAATCTCGAGATTCAGGTTCCAATTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-2021s1c1
Sequence:CCGGGCATTCCCAATGCAGATGTTTCTCGAGAAACATCTGCATTGGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-878s1c1
Sequence:CCGGCCCGCATAGTACCTCCTTCAACTCGAGTTGAAGGAGGTACTATGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376905.1-1653s1c1
Sequence:CCGGCGAGGGAAATTGCATCAAGAACTCGAGTTCTTGATGCAATTTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:XM_376905.1-1460s1c1
Sequence:CCGGCGAACTGCAATAAATGTGAAACTCGAGTTTCACATTTATTGCAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)