EMAIL THIS PAGE TO A FRIEND

MEI1

meiosis inhibitor 1

144 Gene Product Result for
Synonyms: SPATA38
Gene ID:
Mouse(74369) meiosis defective 1
Rat(315162) meiosis inhibitor 1
Thale Cress(844068) meiosis defective 1
cow(516011) meiosis inhibitor 1
Horse(100055929) meiosis inhibitor 1
dog(609694) meiosis inhibitor 1
domestic cat(101089876) meiosis inhibitor 1
chicken(417985) meiosis inhibitor 1
domestic guinea pig(100718119) meiosis inhibitor 1
naked mole-rat(101701815) meiosis inhibitor 1
sheep(101103890) meiosis inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152513 Rosetta Predictions human pricing
NM_001130555 Rosetta Predictions rat pricing
XM_487041 Rosetta Predictions mouse pricing
XM_894546 Rosetta Predictions mouse pricing
XM_901647 Rosetta Predictions mouse pricing
XM_901649 Rosetta Predictions mouse pricing
XM_920920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366296 predicted 2251
2 SASI_Hs01_00093514 predicted 2450
3 SASI_Hs01_00093515 predicted 357
4 SASI_Hs01_00093516 predicted 1000
5 SASI_Hs01_00093517 predicted 1895
6 SASI_Hs02_00366297 predicted 2662
7 SASI_Hs01_00093518 predicted 2268
8 SASI_Hs01_00093519 predicted 607
9 SASI_Hs01_00093520 predicted 766
10 SASI_Hs01_00093521 predicted 2160
11 SASI_Hs01_00093522 predicted 2643
12 SASI_Hs01_00093523 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255719 predicted 2838
2 SASI_Rn02_00255720 predicted 548
3 SASI_Rn02_00255721 predicted 3506
4 SASI_Rn02_00255722 predicted 756
5 SASI_Rn02_00255723 predicted 3550
6 SASI_Rn02_00255724 predicted 1802
7 SASI_Rn02_00255725 predicted 2134
8 SASI_Rn02_00255726 predicted 3122
9 SASI_Rn02_00255727 predicted 3563
10 SASI_Rn02_00255728 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284250 predicted 949
2 SASI_Mm01_00284251 predicted 1113
3 SASI_Mm01_00284252 predicted 1116
4 SASI_Mm01_00284253 predicted 1256
5 SASI_Mm01_00284254 predicted 947
6 SASI_Mm01_00284255 predicted 888
7 SASI_Mm01_00284256 predicted 1286
8 SASI_Mm01_00284257 predicted 1041
9 SASI_Mm01_00284258 predicted 1201
10 SASI_Mm01_00284259 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207754 predicted 547
2 SASI_Mm01_00207755 predicted 577
3 SASI_Mm01_00207756 predicted 572
4 SASI_Mm01_00207757 predicted 716
5 SASI_Mm01_00207758 predicted 744
6 SASI_Mm01_00207759 predicted 506
7 SASI_Mm01_00207760 predicted 655
8 SASI_Mm01_00207761 predicted 590
9 SASI_Mm01_00207762 predicted 502
10 SASI_Mm01_00207763 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245453 predicted 532
2 SASI_Mm01_00245454 predicted 530
3 SASI_Mm01_00245455 predicted 384
4 SASI_Mm01_00245456 predicted 493
5 SASI_Mm01_00245457 predicted 496
6 SASI_Mm01_00245458 predicted 383
7 SASI_Mm01_00245459 predicted 388
8 SASI_Mm01_00245460 predicted 441
9 SASI_Mm01_00245461 predicted 533
10 SASI_Mm01_00245462 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430181 predicted 2403
2 SASI_Mm02_00430182 predicted 3295
3 SASI_Mm02_00430183 predicted 3245
4 SASI_Mm01_00256374 predicted 1899
5 SASI_Mm02_00430184 predicted 1946
6 SASI_Mm02_00430185 predicted 3425
7 SASI_Mm02_00430186 predicted 3300
8 SASI_Mm02_00430187 predicted 3251
9 SASI_Mm01_00256378 predicted 1333
10 SASI_Mm02_00430188 predicted 1303
11 SASI_Mm01_00256370 predicted 568
12 SASI_Mm01_00256371 predicted 375
13 SASI_Mm01_00256372 predicted 1106
14 SASI_Mm01_00256373 predicted 1133
15 SASI_Mm01_00256375 predicted 598
16 SASI_Mm01_00256376 predicted 1079
17 SASI_Mm01_00256377 predicted 734
18 SASI_Mm01_00256379 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_920920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442894 predicted 3862
2 SASI_Mm02_00442895 predicted 2409
3 SASI_Mm02_00442896 predicted 3289
4 SASI_Mm02_00442897 predicted 3462
5 SASI_Mm02_00442898 predicted 3507
6 SASI_Mm02_00442899 predicted 842
7 SASI_Mm02_00442900 predicted 857
8 SASI_Mm02_00442901 predicted 1891
9 SASI_Mm02_00442902 predicted 1110
10 SASI_Mm02_00442903 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028897
MEI1 MISSION shRNA Bacterial Glycerol Stock
meiosis inhibitor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-374s21c1
Sequence:CCGGGCTCACTACTCAGCCGAATATCTCGAGATATTCGGCTGAGTAGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3093s21c1
Sequence:CCGGTTGCAGGTCCATCGGACATTACTCGAGTAATGTCCGATGGACCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3578s21c1
Sequence:CCGGACGTGAAGAGGTGGGTCTTATCTCGAGATAAGACCCACCTCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2041s21c1
Sequence:CCGGTCCTGTCAGATCGGCAGTATGCTCGAGCATACTGCCGATCTGACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2533s21c1
Sequence:CCGGCGCCCAGCATCCTACTCATTTCTCGAGAAATGAGTAGGATGCTGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028897
MEI1 MISSION shRNA shRNA Plasmid DNA
meiosis inhibitor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-374s21c1
Sequence:CCGGGCTCACTACTCAGCCGAATATCTCGAGATATTCGGCTGAGTAGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3093s21c1
Sequence:CCGGTTGCAGGTCCATCGGACATTACTCGAGTAATGTCCGATGGACCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3578s21c1
Sequence:CCGGACGTGAAGAGGTGGGTCTTATCTCGAGATAAGACCCACCTCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2041s21c1
Sequence:CCGGTCCTGTCAGATCGGCAGTATGCTCGAGCATACTGCCGATCTGACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2533s21c1
Sequence:CCGGCGCCCAGCATCCTACTCATTTCTCGAGAAATGAGTAGGATGCTGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028897
MEI1 MISSION shRNA Lentiviral Transduction Particles
meiosis inhibitor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-374s21c1
Sequence:CCGGGCTCACTACTCAGCCGAATATCTCGAGATATTCGGCTGAGTAGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3093s21c1
Sequence:CCGGTTGCAGGTCCATCGGACATTACTCGAGTAATGTCCGATGGACCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-3578s21c1
Sequence:CCGGACGTGAAGAGGTGGGTCTTATCTCGAGATAAGACCCACCTCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2041s21c1
Sequence:CCGGTCCTGTCAGATCGGCAGTATGCTCGAGCATACTGCCGATCTGACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028897.3-2533s21c1
Sequence:CCGGCGCCCAGCATCCTACTCATTTCTCGAGAAATGAGTAGGATGCTGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152513
MEI1 MISSION shRNA Bacterial Glycerol Stock
meiosis inhibitor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1531s21c1
Sequence:CCGGCAGCACTCTGGAGGGATTTAGCTCGAGCTAAATCCCTCCAGAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2334s21c1
Sequence:CCGGCAGACCTGCAGCTAGTCTATACTCGAGTATAGACTAGCTGCAGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2598s21c1
Sequence:CCGGCAGCTCACAAGGTACTGATTACTCGAGTAATCAGTACCTTGTGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1904s21c1
Sequence:CCGGTCCAATTTCCTCTACTATATGCTCGAGCATATAGTAGAGGAAATTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2650s21c1
Sequence:CCGGTATCCAAGTGGGCGGTCTTATCTCGAGATAAGACCGCCCACTTGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152513
MEI1 MISSION shRNA shRNA Plasmid DNA
meiosis inhibitor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1531s21c1
Sequence:CCGGCAGCACTCTGGAGGGATTTAGCTCGAGCTAAATCCCTCCAGAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2334s21c1
Sequence:CCGGCAGACCTGCAGCTAGTCTATACTCGAGTATAGACTAGCTGCAGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2598s21c1
Sequence:CCGGCAGCTCACAAGGTACTGATTACTCGAGTAATCAGTACCTTGTGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1904s21c1
Sequence:CCGGTCCAATTTCCTCTACTATATGCTCGAGCATATAGTAGAGGAAATTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2650s21c1
Sequence:CCGGTATCCAAGTGGGCGGTCTTATCTCGAGATAAGACCGCCCACTTGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152513
MEI1 MISSION shRNA Lentiviral Transduction Particles
meiosis inhibitor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1531s21c1
Sequence:CCGGCAGCACTCTGGAGGGATTTAGCTCGAGCTAAATCCCTCCAGAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2334s21c1
Sequence:CCGGCAGACCTGCAGCTAGTCTATACTCGAGTATAGACTAGCTGCAGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2598s21c1
Sequence:CCGGCAGCTCACAAGGTACTGATTACTCGAGTAATCAGTACCTTGTGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-1904s21c1
Sequence:CCGGTCCAATTTCCTCTACTATATGCTCGAGCATATAGTAGAGGAAATTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152513.3-2650s21c1
Sequence:CCGGTATCCAAGTGGGCGGTCTTATCTCGAGATAAGACCGCCCACTTGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)