EMAIL THIS PAGE TO A FRIEND

MEIG1

meiosis/spermiogenesis associated 1

74 Gene Product Result for
Synonyms: SPATA39 bA2K17.3
UniProtKB ID: Q5JSS6
Gene ID:
Mouse(104362) meiosis expressed gene 1
Rat(679834) meiosis/spermiogenesis associated 1
Zebrafish(541343) meiosis expressed gene 1 homolog
domestic cat(101089778) meiosis expressed gene 1 homolog (mouse)
cow(617353) meiosis expressed gene 1 homolog (mouse)
dog(100684014) meiosis expressed gene 1 homolog (mouse)
chicken(769589) meiosis expressed gene 1 homolog (mouse)
domestic guinea pig(100728794) meiosis expressed gene 1 homolog (mouse)
naked mole-rat(101699891) meiosis expressed gene 1 homolog (mouse)
sheep(101109199) meiosis expressed gene 1 homolog (mouse)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008579 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008579 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008579 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080836 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103971 MISSION® esiRNA esiRNA human MEIG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080836 Rosetta Predictions human pricing
XM_927975 Rosetta Predictions human pricing
NM_001134882 Rosetta Predictions rat pricing
XM_001055664 Rosetta Predictions rat pricing
NM_008579 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316064 predicted 253
2 SASI_Hs02_00316065 predicted 239
3 SASI_Hs02_00316066 predicted 253
4 SASI_Hs02_00316067 predicted 245
5 SASI_Hs02_00316068 predicted 242
6 SASI_Hs02_00316069 predicted 327
7 SASI_Hs02_00316070 predicted 402
8 SASI_Hs02_00316071 predicted 215
9 SASI_Hs02_00316072 predicted 331
10 SASI_Hs02_00316073 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296116 predicted 256
2 SASI_Hs01_00296117 predicted 424
3 SASI_Hs01_00296118 predicted 414
4 SASI_Hs01_00296119 predicted 424
5 SASI_Hs01_00296120 predicted 416
6 SASI_Hs01_00296121 predicted 504
7 SASI_Hs01_00296122 predicted 325
8 SASI_Hs01_00296123 predicted 258
9 SASI_Hs01_00296124 predicted 576
10 SASI_Hs01_00296125 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134882 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258944 predicted 328
2 SASI_Rn02_00258945 predicted 266
3 SASI_Rn02_00258946 predicted 328
4 SASI_Rn02_00258947 predicted 325
5 SASI_Rn02_00258948 predicted 336
6 SASI_Rn02_00258949 predicted 252
7 SASI_Rn02_00258950 predicted 298
8 SASI_Rn02_00258951 predicted 275
9 SASI_Rn02_00258952 predicted 246
10 SASI_Rn02_00258953 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280551 predicted 376
2 SASI_Rn02_00280552 predicted 314
3 SASI_Rn02_00280553 predicted 384
4 SASI_Rn02_00280554 predicted 374
5 SASI_Rn02_00280555 predicted 391
6 SASI_Rn02_00280556 predicted 299
7 SASI_Rn02_00280557 predicted 339
8 SASI_Rn02_00280558 predicted 327
9 SASI_Rn02_00280559 predicted 291
10 SASI_Rn02_00280560 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008579 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314208 predicted 329
2 SASI_Mm01_00038302 predicted 322
3 SASI_Mm02_00314209 predicted 314
4 SASI_Mm01_00038305 predicted 326
5 SASI_Mm02_00314210 predicted 369
6 SASI_Mm02_00314211 predicted 359
7 SASI_Mm02_00314212 predicted 374
8 SASI_Mm01_00038310 predicted 462
9 SASI_Mm02_00314213 predicted 414
10 SASI_Mm02_00314214 predicted 422
11 SASI_Mm01_00038303 predicted 441
12 SASI_Mm01_00038304 predicted 380
13 SASI_Mm01_00038306 predicted 465
14 SASI_Mm01_00038307 predicted 394
15 SASI_Mm01_00038308 predicted 373
16 SASI_Mm01_00038309 predicted 469
17 SASI_Mm01_00038311 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008579
MEIG1 MISSION shRNA Bacterial Glycerol Stock
meiosis/spermiogenesis associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008579.4-582s1c1
Sequence:CCGGCTCCTTTAAGAATTGGTTGTTCTCGAGAACAACCAATTCTTAAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-467s1c1
Sequence:CCGGGCGGAGGGACAATACTTTCTTCTCGAGAAGAAAGTATTGTCCCTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-375s1c1
Sequence:CCGGGCAGGATATCGGGATGAAATTCTCGAGAATTTCATCCCGATATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-372s1c1
Sequence:CCGGCAAGCAGGATATCGGGATGAACTCGAGTTCATCCCGATATCCTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-327s1c1
Sequence:CCGGGCCAAGAAATGGTCAGAGGAACTCGAGTTCCTCTGACCATTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008579
MEIG1 MISSION shRNA shRNA Plasmid DNA
meiosis/spermiogenesis associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008579.4-582s1c1
Sequence:CCGGCTCCTTTAAGAATTGGTTGTTCTCGAGAACAACCAATTCTTAAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-467s1c1
Sequence:CCGGGCGGAGGGACAATACTTTCTTCTCGAGAAGAAAGTATTGTCCCTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-375s1c1
Sequence:CCGGGCAGGATATCGGGATGAAATTCTCGAGAATTTCATCCCGATATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-372s1c1
Sequence:CCGGCAAGCAGGATATCGGGATGAACTCGAGTTCATCCCGATATCCTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-327s1c1
Sequence:CCGGGCCAAGAAATGGTCAGAGGAACTCGAGTTCCTCTGACCATTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008579
MEIG1 MISSION shRNA Lentiviral Transduction Particles
meiosis/spermiogenesis associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008579.4-582s1c1
Sequence:CCGGCTCCTTTAAGAATTGGTTGTTCTCGAGAACAACCAATTCTTAAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-467s1c1
Sequence:CCGGGCGGAGGGACAATACTTTCTTCTCGAGAAGAAAGTATTGTCCCTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-375s1c1
Sequence:CCGGGCAGGATATCGGGATGAAATTCTCGAGAATTTCATCCCGATATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-372s1c1
Sequence:CCGGCAAGCAGGATATCGGGATGAACTCGAGTTCATCCCGATATCCTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008579.4-327s1c1
Sequence:CCGGGCCAAGAAATGGTCAGAGGAACTCGAGTTCCTCTGACCATTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080836
VALIDATED
MEIG1 MISSION shRNA Bacterial Glycerol Stock
meiosis/spermiogenesis associated 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-330s21c1
Sequence:CCGGGAAGGGACAATACGTTCTATTCTCGAGAATAGAACGTATTGTCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-418s21c1
Sequence:CCGGTGTCTTCTTTGTATTACTTGTCTCGAGACAAGTAATACAAAGAAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-266s21c1
Sequence:CCGGCAAGTGAAACAAGTTTCTATGCTCGAGCATAGAAACTTGTTTCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-243s21c1
Sequence:CCGGATCGGGATGAAACCGAATATACTCGAGTATATTCGGTTTCATCCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-363s21c1
Sequence:CCGGAGAGGGAATGTGATGACAAAGCTCGAGCTTTGTCATCACATTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080836
VALIDATED
MEIG1 MISSION shRNA shRNA Plasmid DNA
meiosis/spermiogenesis associated 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-330s21c1
Sequence:CCGGGAAGGGACAATACGTTCTATTCTCGAGAATAGAACGTATTGTCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-418s21c1
Sequence:CCGGTGTCTTCTTTGTATTACTTGTCTCGAGACAAGTAATACAAAGAAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-266s21c1
Sequence:CCGGCAAGTGAAACAAGTTTCTATGCTCGAGCATAGAAACTTGTTTCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-243s21c1
Sequence:CCGGATCGGGATGAAACCGAATATACTCGAGTATATTCGGTTTCATCCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-363s21c1
Sequence:CCGGAGAGGGAATGTGATGACAAAGCTCGAGCTTTGTCATCACATTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080836
VALIDATED
MEIG1 MISSION shRNA Lentiviral Transduction Particles
meiosis/spermiogenesis associated 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-330s21c1
Sequence:CCGGGAAGGGACAATACGTTCTATTCTCGAGAATAGAACGTATTGTCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-418s21c1
Sequence:CCGGTGTCTTCTTTGTATTACTTGTCTCGAGACAAGTAATACAAAGAAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-266s21c1
Sequence:CCGGCAAGTGAAACAAGTTTCTATGCTCGAGCATAGAAACTTGTTTCACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080836.2-243s21c1
Sequence:CCGGATCGGGATGAAACCGAATATACTCGAGTATATTCGGTTTCATCCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080836.2-363s21c1
Sequence:CCGGAGAGGGAATGTGATGACAAAGCTCGAGCTTTGTCATCACATTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)