EMAIL THIS PAGE TO A FRIEND

MEIOB

meiosis specific with OB domains

59 Gene Product Result for
Synonyms: C16orf73 gs129
UniProtKB ID: Q8N635, B1AK39, C9J0S1, Q96RY0
Gene ID:
Mouse(75178) meiosis specific with OB domains
Rat(685099) meiosis specific with OB domains
sheep(101113643) meiosis specific with OB domains
naked mole-rat(101724804) meiosis specific with OB domains
domestic guinea pig(100729854) meiosis specific with OB domains
Zebrafish(101882335) meiosis specific with OB domains
cow(618487) meiosis specific with OB domains
domestic cat(101085012) meiosis specific with OB domains
dog(100685856) meiosis specific with OB domains
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152764 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152764 Rosetta Predictions human pricing
XM_001062299 Rosetta Predictions rat pricing
XM_128478 Rosetta Predictions mouse pricing
XM_914580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012161 predicted 558
2 SASI_Hs01_00012162 predicted 753
3 SASI_Hs01_00012163 predicted 638
4 SASI_Hs01_00012164 predicted 748
5 SASI_Hs01_00012165 predicted 494
6 SASI_Hs01_00012168 predicted 501
7 SASI_Hs01_00012169 predicted 619
8 SASI_Hs01_00012170 predicted 1015
9 SASI_Hs02_00366701 predicted 584
10 SASI_Hs02_00366702 predicted 582
11 SASI_Hs01_00012166 predicted 781
12 SASI_Hs01_00012167 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062299 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302996 predicted 1300
2 SASI_Rn02_00302997 predicted 1233
3 SASI_Rn02_00302998 predicted 1295
4 SASI_Rn02_00302999 predicted 1279
5 SASI_Rn02_00303000 predicted 1244
6 SASI_Rn02_00303001 predicted 1284
7 SASI_Rn02_00303002 predicted 1241
8 SASI_Rn02_00303003 predicted 1292
9 SASI_Rn02_00303004 predicted 1249
10 SASI_Rn02_00303005 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209947 predicted 393
2 SASI_Mm01_00209948 predicted 534
3 SASI_Mm02_00424258 predicted 516
4 SASI_Mm01_00209949 predicted 491
5 SASI_Mm01_00209950 predicted 549
6 SASI_Mm01_00209951 predicted 419
7 SASI_Mm01_00209952 predicted 397
8 SASI_Mm02_00424259 predicted 420
9 SASI_Mm01_00209953 predicted 492
10 SASI_Mm01_00209955 predicted 537
11 SASI_Mm01_00209954 predicted 471
12 SASI_Mm01_00209956 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438687 predicted 343
2 SASI_Mm02_00438688 predicted 535
3 SASI_Mm02_00438689 predicted 299
4 SASI_Mm02_00438690 predicted 673
5 SASI_Mm02_00438691 predicted 204
6 SASI_Mm02_00438692 predicted 198
7 SASI_Mm02_00438693 predicted 556
8 SASI_Mm02_00438694 predicted 731
9 SASI_Mm02_00438695 predicted 306
10 SASI_Mm02_00438696 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029197
MEIOB MISSION shRNA Bacterial Glycerol Stock
meiosis specific with OB domains
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-1241s21c1
Sequence:CCGGACTTTGGGCTGCACGATAAATCTCGAGATTTATCGTGCAGCCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-785s21c1
Sequence:CCGGGTAATCTCAAAGACCATTATCCTCGAGGATAATGGTCTTTGAGATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029197.1-1515s21c1
Sequence:CCGGAGCTTGAGAATTATGTGTAAACTCGAGTTTACACATAATTCTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-524s21c1
Sequence:CCGGAGTCTTGATGGGAGGATTATTCTCGAGAATAATCCTCCCATCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-362s21c1
Sequence:CCGGGCAACTCCTAGCAACTATAAACTCGAGTTTATAGTTGCTAGGAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029197
MEIOB MISSION shRNA shRNA Plasmid DNA
meiosis specific with OB domains
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-1241s21c1
Sequence:CCGGACTTTGGGCTGCACGATAAATCTCGAGATTTATCGTGCAGCCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-785s21c1
Sequence:CCGGGTAATCTCAAAGACCATTATCCTCGAGGATAATGGTCTTTGAGATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029197.1-1515s21c1
Sequence:CCGGAGCTTGAGAATTATGTGTAAACTCGAGTTTACACATAATTCTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-524s21c1
Sequence:CCGGAGTCTTGATGGGAGGATTATTCTCGAGAATAATCCTCCCATCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-362s21c1
Sequence:CCGGGCAACTCCTAGCAACTATAAACTCGAGTTTATAGTTGCTAGGAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029197
MEIOB MISSION shRNA Lentiviral Transduction Particles
meiosis specific with OB domains
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-1241s21c1
Sequence:CCGGACTTTGGGCTGCACGATAAATCTCGAGATTTATCGTGCAGCCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-785s21c1
Sequence:CCGGGTAATCTCAAAGACCATTATCCTCGAGGATAATGGTCTTTGAGATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029197.1-1515s21c1
Sequence:CCGGAGCTTGAGAATTATGTGTAAACTCGAGTTTACACATAATTCTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-524s21c1
Sequence:CCGGAGTCTTGATGGGAGGATTATTCTCGAGAATAATCCTCCCATCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029197.1-362s21c1
Sequence:CCGGGCAACTCCTAGCAACTATAAACTCGAGTTTATAGTTGCTAGGAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152764
MEIOB MISSION shRNA Bacterial Glycerol Stock
meiosis specific with OB domains
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-934s1c1
Sequence:CCGGGCACGTTCGTTCTATCACACACTCGAGTGTGTGATAGAACGAACGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152764.1-1154s1c1
Sequence:CCGGGTGGTGAACATGTTTCTAGAACTCGAGTTCTAGAAACATGTTCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-953s1c1
Sequence:CCGGCAGAGCAAGGAGTGGATTGAACTCGAGTTCAATCCACTCCTTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-852s1c1
Sequence:CCGGGTGCTGATTGATCTGACTGATCTCGAGATCAGTCAGATCAATCAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-615s1c1
Sequence:CCGGGATGTCTACACAGTTGAACAACTCGAGTTGTTCAACTGTGTAGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-817s1c1
Sequence:CCGGCCTTGGACTTTAAATCTGTCTCTCGAGAGACAGATTTAAAGTCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-1018s1c1
Sequence:CCGGGCAGAAACTTGTCTGGACAAACTCGAGTTTGTCCAGACAAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-507s1c1
Sequence:CCGGGAAGCTAACATTCTGCTGAATCTCGAGATTCAGCAGAATGTTAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-698s1c1
Sequence:CCGGCTACATTTCCACACTCAACATCTCGAGATGTTGAGTGTGGAAATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-546s1c1
Sequence:CCGGGAAACAAATGTTCTGGATGATCTCGAGATCATCCAGAACATTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152764
MEIOB MISSION shRNA shRNA Plasmid DNA
meiosis specific with OB domains
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-934s1c1
Sequence:CCGGGCACGTTCGTTCTATCACACACTCGAGTGTGTGATAGAACGAACGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152764.1-1154s1c1
Sequence:CCGGGTGGTGAACATGTTTCTAGAACTCGAGTTCTAGAAACATGTTCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-953s1c1
Sequence:CCGGCAGAGCAAGGAGTGGATTGAACTCGAGTTCAATCCACTCCTTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-852s1c1
Sequence:CCGGGTGCTGATTGATCTGACTGATCTCGAGATCAGTCAGATCAATCAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-615s1c1
Sequence:CCGGGATGTCTACACAGTTGAACAACTCGAGTTGTTCAACTGTGTAGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-817s1c1
Sequence:CCGGCCTTGGACTTTAAATCTGTCTCTCGAGAGACAGATTTAAAGTCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-1018s1c1
Sequence:CCGGGCAGAAACTTGTCTGGACAAACTCGAGTTTGTCCAGACAAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-507s1c1
Sequence:CCGGGAAGCTAACATTCTGCTGAATCTCGAGATTCAGCAGAATGTTAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-698s1c1
Sequence:CCGGCTACATTTCCACACTCAACATCTCGAGATGTTGAGTGTGGAAATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-546s1c1
Sequence:CCGGGAAACAAATGTTCTGGATGATCTCGAGATCATCCAGAACATTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152764
MEIOB MISSION shRNA Lentiviral Transduction Particles
meiosis specific with OB domains
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-934s1c1
Sequence:CCGGGCACGTTCGTTCTATCACACACTCGAGTGTGTGATAGAACGAACGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152764.1-1154s1c1
Sequence:CCGGGTGGTGAACATGTTTCTAGAACTCGAGTTCTAGAAACATGTTCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-953s1c1
Sequence:CCGGCAGAGCAAGGAGTGGATTGAACTCGAGTTCAATCCACTCCTTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-852s1c1
Sequence:CCGGGTGCTGATTGATCTGACTGATCTCGAGATCAGTCAGATCAATCAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-615s1c1
Sequence:CCGGGATGTCTACACAGTTGAACAACTCGAGTTGTTCAACTGTGTAGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-817s1c1
Sequence:CCGGCCTTGGACTTTAAATCTGTCTCTCGAGAGACAGATTTAAAGTCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-1018s1c1
Sequence:CCGGGCAGAAACTTGTCTGGACAAACTCGAGTTTGTCCAGACAAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-507s1c1
Sequence:CCGGGAAGCTAACATTCTGCTGAATCTCGAGATTCAGCAGAATGTTAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-698s1c1
Sequence:CCGGCTACATTTCCACACTCAACATCTCGAGATGTTGAGTGTGGAAATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152764.1-546s1c1
Sequence:CCGGGAAACAAATGTTCTGGATGATCTCGAGATCATCCAGAACATTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)